Previous Contig 008714:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007C18Sequence627008714 (18)gb:AF227979_17788895e-65Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.640008714 (18)gb:AF227979_17788898e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMFF011H14Sequence461008714 (18)gb:AF227979_17788894e-63Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.706008714 (18)gb:AF227979_17788896e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMFF018K24Sequence491008714 (18)gb:AF227979_17788891e-64Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.691008714 (18)gb:AF227979_17788896e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMFF032B11Sequence240008714 (18)212008714 (18)
JMFN010G24Sequence611008714 (18)gb:AF227979_17788892e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMFN020I15Sequence636008714 (18)gb:AF227979_17788895e-72Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMFN031C08Sequence612008714 (18)gb:AF227979_17788892e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMFN046D23Sequence613008714 (18)gb:AF227979_17788892e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMSF007P14Sequence234008714 (18)gb:AF227979_17788892e-19Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.628008714 (18)gb:AF227979_17788892e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMSF030F17Sequence635006660 (5)gb:AF280812_17828972e-38Glycine max putative Hs1pro-1-like receptor mRNA, complete cds.671008714 (18)gb:AF227979_17788892e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMSF050A11Sequence668007964 (2)gb:AC145379_17443455e-25Oryza sativa chromosome 3 BAC OSJNBa0010N03 genomic sequence, complete sequence.695008714 (18)gb:AF227979_17788893e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.
JMSF050N22Sequence676008714 (18)gb:AF227979_17788892e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.667008714 (18)gb:AF227979_17788892e-73Euphorbia esula 40S ribosomal protein S16 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF032B11+ TTTTTTTTTTCGAAT
                      ____________________________________________________________
consensus TTTTTTTTTTCGAAT
 
. : . : . : . : . : . :
rJMFF032B11- ATTTCTACCTCACGCAAAGCTCAAGGTCGATGAAAACCGTCTCATGT
JMFF032B11+ AAGACATTTTAATATTTCTACCTCACGCAAAGCTCAAGGTCGATGAAAACCGTCTCATGT
rJMFF018K24- ATATTTCTACCTCACGCAAAGCTCAAGGTCGATGAAAACCGTCTCATGT
rJMSF050N22- AAGCTCAAGGTCGATGAAAACCGTCTCATGT
JMFN046D23+ AGGTCGATGAAAACCGTCTCATGT
JMFN010G24+ TCATGT
rJMSF030F17- AAGCTCAAGGTCGATGAAAACCGTCTCATGT
JMSF050N22+ CTACCTCACGCAAAGCTCAAGGTCGATGAAAACCGTCTCATGT
rJMFF007C18- TGT
rJMFF011H14- ATATTTCTACCTCACGCAAAGCTCAAGGTCGATGAAAACCGTCTCATGT
                      ____________________________________________________________
consensus AAGACATTTTAATATTTCTACCTCACGCAAAGCTCAAGGTCGATGAAAACCGTCTCATGT
 
. : . : . : . : . : . :
rJMFF032B11- AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
JMFF032B11+ AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
rJMFF018K24- AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
rJMSF050N22- AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
JMFN046D23+ AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
JMFN010G24+ AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
JMFN031C08+ CATTTCAGACAAGAGTAAATTAATACAGAGCATCAAAATNCCGAATAATTAAACAAA
rJMSF030F17- AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
JMSF050N22+ AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
rJMFF007C18- AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
rJMSF007P14- AACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
JMFF007C18+ TCAGACAAGAGTAAANTAATACAGAGCATCAAAATNCCGAATAATTAAACAAA
rJMFF011H14- AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
                      ____________________________________________________________
consensus AGTCATTTCAGACAAGAGTAAACTAATACAGAGCATCAAAATACCGAATAATTAAACAAA
 
. : . : . : . : . : . :
rJMFF032B11- AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
JMFF032B11+ AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
rJMFF018K24- AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
rJMSF050N22- AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
JMFN046D23+ AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
JMFN010G24+ AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
JMFN031C08+ AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
rJMSF030F17- AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
JMSF050N22+ AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
rJMFF007C18- AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
rJMSF007P14- AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
JMFF007C18+ AAACATGAAAATTNTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
rJMFF011H14- AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
                      ____________________________________________________________
consensus AAACATGAAAATTCTGATAATAATAACCATAATACTTTCGGTATATAAAGCAGAACTGTG
 
. : . : . : . : . : . :
rJMFF032B11- TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCA
JMFF032B11+ TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCA
rJMFF018K24- TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
rJMSF050N22- TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
JMFN046D23+ TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
JMFN010G24+ TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
JMFN031C08+ TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
rJMSF030F17- TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
rJMSF050A11- AACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
JMSF050N22+ TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
rJMFF007C18- TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
rJMSF007P14- TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
JMFF007C18+ TTGAGCAATTAACGGTAGGACTTCTGGAACCCTGGCACGAGCACCACGACCTCCCGAAC-
JMFF018K24+ TGGCACGAGCACCACGACCT-CCGAACT
JMFN020I15+ TCAACGGTAAGACTTCTGGAA-CCTGGCACGAGCACCGCGACCA-CCGAAC-
rJMFF011H14- TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
                      ____________________________________________________________
consensus TTGAGCAATTAACGGTAGGACTTCTGGAA-CCTGGCACGAGCACCACGACCT-CCGAAC-
 
. : . : . : . : . : . :
rJMFF018K24- TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
rJMSF050N22- TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
JMFN046D23+ TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
JMFN010G24+ TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
JMFN031C08+ TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
rJMSF030F17- TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
rJMSF050A11- TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
JMSF050N22+ TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
rJMFF007C18- TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
rJMSF007P14- TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
JMFF007C18+ TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
JMFF018K24+ TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
JMFF011H14+ TTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
JMFN020I15+ TTCTTGGGCTCGCAGCGCCTGGGGTCGGCAACGAGCAACGTCCTGTCGTAGCGCACGAGT
rJMFF011H14- TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
                      ____________________________________________________________
consensus TTCTTTGGCTCGCAGCGCCTTGGATCAGCAACAAGCAAGGTCCTGTCGTAGCGAACGAGG
 
. : . : . : . : . : . :
rJMFF018K24- ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
rJMSF050N22- ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
JMFN046D23+ ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
JMFN010G24+ ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
JMFN031C08+ ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
rJMSF030F17- ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
rJMSF050A11- ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
JMSF050N22+ ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
rJMFF007C18- ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
rJMSF007P14- ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
JMFF007C18+ ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
JMFF018K24+ ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
JMFF011H14+ ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
JMFN020I15+ ATGTCCTTTATCTCCTTCTTCGACTGTTCGTCGACGTACTTCTGGTAAAAGGCGACGAGG
rJMFF011H14- ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
                      ____________________________________________________________
consensus ATATCCTTGATCTCCTTCTTCGACTGCTCGTCCACGTACTTCTGGTAGAACGCGACGAGG
 
. : . : . : . : . : . :
rJMFF018K24- GCCTTGGCAATGGCCTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
rJMSF050N22- GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
JMFN046D23+ GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
JMFN010G24+ GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
JMFN031C08+ GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
rJMSF030F17- GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
rJMSF050A11- GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
JMSF050N22+ GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
rJMFF007C18- GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
rJMSF007P14- GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
JMFF007C18+ GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
JMFF018K24+ GCCTTGGCAATGGCCTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
JMFF011H14+ GCCTTGGCAATGGCCTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
JMFN020I15+ GCCTTGGCAATAGACTGGCGGATGGCGTATATTTGGGAGGTGTGACCGCCGCCCTTGACG
rJMFF011H14- GCCTTGGCAATGGCCTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
                      ____________________________________________________________
consensus GCCTTGGCAATGGACTGACGGATGGCGTAGATCTGAGAGGTGTGACCTCCGCCCTTGACG
 
. : . : . : . : . : . :
rJMFF018K24- CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
rJMSF050N22- CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
JMFN046D23+ CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
JMFN010G24+ CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
JMFN031C08+ CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
rJMSF030F17- CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
rJMSF050A11- CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
JMSF050N22+ CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
rJMFF007C18- CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
rJMSF007P14- CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
JMFF007C18+ CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
JMFF018K24+ CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
JMFF011H14+ CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
JMFN020I15+ CGGATTCGCATGTCCACTCCGGCGAATCTGTGGCGCCCCAAAAGGAGGATGGGCTCGAAG
JMSF007P14+ GGCTCGAAC
rJMFF011H14- CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
                      ____________________________________________________________
consensus CGGATGCGCATGTCCACGCCGGCGAAACGGTGTCGGCCCAATAGGAGGATGGGCTCGAAC
 
. : . : . : . : . : . :
rJMFF018K24- GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
rJMSF050N22- GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
JMFN046D23+ GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
JMFN010G24+ GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
JMFN031C08+ GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
rJMSF030F17- GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
rJMSF050A11- GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
JMSF050N22+ GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
rJMFF007C18- GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
rJMSF007P14- GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
JMFF007C18+ GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
JMFF018K24+ GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
JMFF011H14+ GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
JMFN020I15+ GCCTTGTAGCGGAGAATCTCCGGCTGGATGAGCTCGATTGGAACGCCATTGATCTTTATG
JMSF007P14+ GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
rJMFF011H14- GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
                      ____________________________________________________________
consensus GCCTTGTAGCGGAGAATCTCGGGCTGGATCAGCTCGATTGGAACGCCGTTGATCTTGATG
 
. : . : . : . : . : . :
rJMFF018K24- AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
rJMSF050N22- AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
JMFN046D23+ AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
JMFN010G24+ AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
JMFN031C08+ AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
rJMSF030F17- AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
rJMSF050A11- AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
JMSF050N22+ AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
rJMFF007C18- AGTCCATGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
rJMSF007P14- AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
JMFF007C18+ AGTCCATGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
JMFF018K24+ AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
JMFF011H14+ AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
JMFN020I15+ AGGCCACGACCGCGTTTGCAGTGGGTAACGGCAACTGCAGTCTTTTTCCGTCCGAAACAC
JMSF007P14+ AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
rJMFF011H14- AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
                      ____________________________________________________________
consensus AGTCCACGGCCGCGCTTGCAGTGAGTCACGGCAACCGCCGTCTTCTTACGACCGAAGCAT
 
. : . : . : . : . : . :
rJMFF018K24- TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
rJMSF050N22- TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
JMFN046D23+ TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCG
JMFN010G24+ TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
JMFN031C08+ TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
rJMSF030F17- TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
rJMSF050A11- TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
JMSF050N22+ TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
rJMFF007C18- TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
rJMSF007P14- TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
JMFF007C18+ TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
JMFF018K24+ TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
JMFF011H14+ TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
JMFN020I15+ TGAACCGATTCTACCG
JMSF007P14+ TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
rJMFF011H14- TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
                      ____________________________________________________________
consensus TGAACTGATTCTACCGGTGCTGCCGCCATTCTGGTGGTTCTCCTCTGTCGCGGGGAATAG
 
. : . : . : . : . : . :
rJMFF018K24- AGAAACCCTACTCTGCAACCTGCTAACCTGCGTACAGAAA
rJMSF050N22- AGAAACCCTACTCTGCAACCTGCTAACCTGC
JMFN010G24+ AGAAACCC
JMFN031C08+ AGAAACCCTACTCTGCAA
rJMSF030F17- AGAAACCCTACTCTGCAACCTGCTAACCTG
rJMSF050A11- AGAAACCCTACTCTGCAACCTGCTAAC
JMSF050N22+ AGAAACCCTACTCTGCAACCTGCTAACCTGC
rJMFF007C18- AGAAACCCTACTCTGCAACCTGCTAACCTGCGTAC
rJMSF007P14- AGAAACCCTACTCTGCAACCTGCTAACCTGCGTACAGAAACTTC
JMFF007C18+ AGAAACCCTACTCTGCAACCTGCTAACCTGCGTAC
JMFF018K24+ AGAAACCCTACTCTGCAACCTGCTAACCTGCGTACAGAAACTTC
JMFF011H14+ AGAAACCCTACTCTGCAACCTGCTAACCTGCGTACAGAAACTTC
JMSF007P14+ AGAAACCCTACTCTGCAACCTGCTAACCTGCGTACAGAAACTTC
rJMFF011H14- AGAAACCCTACTCTGCAACCTGCTAACCTGCGTACAGAAACTTCCGGTTCTCGACGAATT
                      ____________________________________________________________
consensus AGAAACCCTACTCTGCAACCTGCTAACCTGCGTACAGAAACTTCCGGTTCTCGACGAATT