Previous Contig 008709:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011G10Sequence617008709 (15)sp|O49203|NDK3_ARATH2e-64Nucleoside diphosphate kinase III, chloroplast/mitochondrial precursor (EC 2.7.4741008709 (15)gb:AB029400_15181843e-93Brassica rapa Bc-NDPK3 mRNA for nucleoside diphosphate kinase 3, partial cds.
JMFF015H10Sequence556008709 (15)sp|O49203|NDK3_ARATH5e-54Nucleoside diphosphate kinase III, chloroplast/mitochondrial precursor (EC 2.7.4771008709 (15)gb:AB029400_15181847e-94Brassica rapa Bc-NDPK3 mRNA for nucleoside diphosphate kinase 3, partial cds.
JMFF019N14Sequence276008709 (15)gb:HSU80761_20264330.021Homo sapiens CTG26 alternate open reading frame mRNA, complete cds.801008709 (15)gb:AB029400_15181844e-93Brassica rapa Bc-NDPK3 mRNA for nucleoside diphosphate kinase 3, partial cds.
JMFF025D19Sequence548008709 (15)sp|O49203|NDK3_ARATH7e-47Nucleoside diphosphate kinase III, chloroplast/mitochondrial precursor (EC 2.7.4665008709 (15)sp|Q8RXA8|NDK4_SPIOL1e-77Nucleoside diphosphate kinase IV, chloroplast precursor (EC 2.7.4.6) (NDK IV) (N
JMFF032A18Sequence536008709 (15)sp|Q8LAH8|NDK4_ARATH6e-35Nucleoside diphosphate kinase IV, chloroplast/mitochondrial precursor (EC 2.7.4.805008709 (15)sp|Q8RXA8|NDK4_SPIOL1e-93Nucleoside diphosphate kinase IV, chloroplast precursor (EC 2.7.4.6) (NDK IV) (N
JMFF035D14Sequence591008709 (15)sp|O49203|NDK3_ARATH5e-43Nucleoside diphosphate kinase III, chloroplast/mitochondrial precursor (EC 2.7.4692008709 (15)gb:AB029400_15181843e-77Brassica rapa Bc-NDPK3 mRNA for nucleoside diphosphate kinase 3, partial cds.
JMSF036A04Sequence700008709 (15)sp|Q8LAH8|NDK4_ARATH7e-81Nucleoside diphosphate kinase IV, chloroplast/mitochondrial precursor (EC 2.7.4.652008709 (15)gb:AB029400_15181847e-88Brassica rapa Bc-NDPK3 mRNA for nucleoside diphosphate kinase 3, partial cds.
JMSF042L08Sequence676020154sp|Q8LAH8|NDK4_ARATH2e-08Nucleoside diphosphate kinase IV, chloroplast/mitochondrial precursor (EC 2.7.4.690008709 (15)gb:AB029400_15181842e-86Brassica rapa Bc-NDPK3 mRNA for nucleoside diphosphate kinase 3, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019N14- ACATTTACCCTACTCAAAAAGTTGCTACTCATTTATATTA
JMFF032A18- ACATTTACCCTACTCAAAAAGTTGCTACTCATTTATATTA
JMFF035D14- ATTTATATTA
                      ____________________________________________________________
consensus ACATTTACCCTACTCAAAAAGTTGCTACTCATTTATATTA
 
. : . : . : . : . : . :
JMFF019N14- TCATCATATTCTCTCCGCTTTACATTTCCATTCCTATCTCCATCGAAGTTAACGAGAGCT
JMFF032A18- TCATCATATTCTCTCCGCTTTACATTTCCATTCCTATCTCCATCGAAGTTAACGAGAGCT
JMFF025D19- ATATTCTCTCCGCTTTACATTTCCATTCCTATCTCCATCGAAGTTAACGAGAGCT
JMFF035D14- TCATCATATTCTCTCCGCTTTACATTTCCATTCCTATCTCCATCGAAGTTAACGAGAGCT
JMFF015H10- ATTCCTATCTCCATCGAAGTTAACGAGAGCT
JMFF011G10- ATCTCCATCGAAGTTAACGAGAGCT
JMSF036A04- TATCTCCATCGAAGTTAACGAGAGCT
                      ____________________________________________________________
consensus TCATCATATTCTCTCCGCTTTACATTTCCATTCCTATCTCCATCGAAGTTAACGAGAGCT
 
. : . : . : . : . : . :
JMFF019N14- CGCATCGTTTTGCTCTTGTCTTCTCTGTTGAGTTTTGATCGAAAATTCTCGAAGATGAGC
JMFF032A18- CGCATCGTTTTGCTCTTGTCTTCTCTGTTGAGTTTTGATCGAAAATTCTCGAAGATGAGC
JMFF025D19- CGCATCGTTTTGCTCTTGTCTTCTCTGTTGAGTTTTGATCGAAAATTCTCGAAGATGAGC
JMFF035D14- CGCATCGTTTTGCTCTTGTCTTCTCTGTTGAGTTTTGATCGAAAATTCTCGAAGATGAGC
JMFF015H10- CGCATCGTTTTGCTCTTGTCTTCTCTGTTGAGTTTTGATCGAAAATTCTCGAAGATGAGC
JMFF011G10- CGCATCGTTTTGCTCTTGTCTTCTCTGTTGAGTTTTGATCGAAAATTCTCGAAGATGAGC
JMSF036A04- CGCATCGTTTTGCTCTTGTCTTCTCTGTTGAGTTTTGATCGAAAATTCTCGAAGATGAGC
                      ____________________________________________________________
consensus CGCATCGTTTTGCTCTTGTCTTCTCTGTTGAGTTTTGATCGAAAATTCTCGAAGATGAGC
 
. : . : . : . : . : . :
JMFF019N14- TCACAGATTTGCAGATCTGTTGCTTCGCGAGCTGCCAGGTCTATTCTCTCTGCTTACTCC
JMFF032A18- TCACAGATTTGCAGATCTGTTGCTTCGCGAGCTGCCAGGTCTATTCTCTCTGCTTACTCC
JMFF025D19- TCACAGATTTGCAGATCTGTTGCTTCGCGAGCTGCCAGGTCTATTCTCTCTGCTTACTCC
JMFF035D14- TCACAGATTTGCAGATCTGTTGCTTCGCGAGCTGCCAGGTCTATTCTCTCTGCTTACTCC
JMFF015H10- TCACAGATTTGCAGATCTGTTGCTTCGCGAGCTGCCAGGTCTATTCTCTCTGCTTACTCC
JMFF011G10- TCACAGATTTGCAGATCTGTTGCTTCGCGAGCTGCCAGGTCTATTCTCTCTGCTTACTCC
JMSF036A04- TCACAGATTTGCAGATCTGTTGCTTCGCGAGCTGCCAGGTCTATTCTCTCTGCTTACTCC
                      ____________________________________________________________
consensus TCACAGATTTGCAGATCTGTTGCTTCGCGAGCTGCCAGGTCTATTCTCTCTGCTTACTCC
 
. : . : . : . : . : . :
JMFF019N14- AAGCAGAGCTCTCGTTCCATTTCCGGAGGGCGAGCAGCTGCTGCTGCTGCTACTGT
JMFF032A18- AAGCAGAGCTCTCGTTCCATTTCCGGAGGGCGAGCAGCTGCTGCTGCTGCTACTGTTTCT
JMFF025D19- AAGCAGAGCTCTCGTTCCATTTCCGGAGGGCGAGCAGCTGCTGCTGCTGCTACTGTTTCT
JMFF035D14- AAGCAGAGCTCTCGTTCCATTTCCGGAGGGCGAGCAGCTGCTGCTGCTGCTACTGTTTCT
JMFF015H10- AAGCAGAGCTCTCGTTCCATTTCCGGAGGGCGAGCAGCTGCTGCTGCTGCTACTGTTTCT
JMFF011G10- AAGCAGAGCTCTCGTTCCATTTCCGGAGGGCGAGCAGCTGCTGCTGCTGCTACTGTTTCT
JMSF036A04- AAGCAGAGCTCTCGTTCCATTTCCGGAGGGCGAGCAGCTGCTGCTGCTGCTACTGTTTCT
rJMFF019N14+ GCAGCTGCTGCTGCTGCTACTGTTTCT
rJMFF015H10+ GAGCAGCTGCTGCTGCTGCTACTGTTTCT
rJMFF032A18+ CGAGCAGCTGCTGCTGCTGCTACTGTTTCT
                      ____________________________________________________________
consensus AAGCAGAGCTCTCGTTCCATTTCCGGAGGGCGAGCAGCTGCTGCTGCTGCTACTGTTTCT
 
. : . : . : . : . : . :
JMFF032A18- CTCAGAGGAGTTGTGCCTTCTCTAGCTGCCTACGGTAGGGAAGAGTCTGCAAATGCCTCT
JMFF025D19- CTCAGAGGAGTTGTGCCTTCTCTAGCTGCCTACGGTAGGGAAGAGTCTGCAAATGCCTCT
JMFF035D14- CTCAGAGGAGTTGTGCCTTCTCTAGCTGCCTACGGTAGGGAAGAGTCTGCAAATGCCTCT
JMFF015H10- CTCAGAGGAGTTGTGCCTTCTCTAGCTGCCTACGGTAGGGAAGAGTCTGCAAATGCCTCT
JMFF011G10- CTCAGAGGAGTTGTGCCTTCTCTAGCTGCCTACGGTAGGGAAGAGTCTGCAAATGCCTCT
JMSF036A04- CTCAGAGGAGTTGTGCCTTCTCTAGCTGCCTACGGTAGGGAGGAGTCTGCAAATGCCTCT
rJMFF019N14+ NTCAGAGGAGTTGTGCNTTCTCTAGCTGCCTACGGTAGGGAAGAGTCTGCAAATGCCTCT
rJMFF015H10+ NTCAGAGGAGTTGTGCCTTCTCTAGCTGCNTACGGTAGGGAAGAGTCTGCAAATGCCTCT
rJMFF032A18+ CTCAGAGGAGTTGTGCNTTCTCTAGCTGCCTACGGTAGGGAAGAGTCTGCAAATGCCTCT
rJMFF011G10+ GGAAGAGTCTGCAAATGCCTCT
                      ____________________________________________________________
consensus CTCAGAGGAGTTGTGCCTTCTCTAGCTGCCTACGGTAGGGAAGAGTCTGCAAATGCCTCT
 
. : . : . : . : . : . :
JMFF032A18- AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
JMFF025D19- AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
JMFF035D14- AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
JMFF015H10- AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
JMFF011G10- AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
JMSF036A04- AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
rJMFF019N14+ AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
rJMFF015H10+ AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
rJMFF032A18+ AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
rJMFF035D14+ TGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
rJMSF036A04+ TCCTGCGGCAGCTTACATGCTCCAGGAGCAA
rJMSF042L08+ CAGCTTACATGCTCCAGGAGCAA
rJMFF025D19+ AGCAA
rJMFF011G10+ AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
                      ____________________________________________________________
consensus AGAGCTTGGATTTCTGGTCTCTTTGCTCTTCCTGCGGCAGCTTACATGCTCCAGGAGCAA
 
. : . : . : . : . : . :
JMFF032A18- GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
JMFF025D19- GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
JMFF035D14- GAAGCATGTGCTGCTGAGATGGAG-GCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
JMFF015H10- GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
JMFF011G10- GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
JMSF036A04- GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
rJMFF019N14+ GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
rJMFF015H10+ GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
rJMFF032A18+ GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
rJMFF035D14+ GAAGCATGTGCTGCTGAGATGGAG-GCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
rJMSF036A04+ GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
rJMSF042L08+ GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
rJMFF025D19+ GAAGCATGTGCTGTTGAGATGGAGCGCACCTTTATAGCAATCAAGCCTTGATGGAGTGCA
rJMFF011G10+ GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
                      ____________________________________________________________
consensus GAAGCATGTGCTGCTGAGATGGAGCGCACCTTTATAGCAATCAAGCC-TGATGGAGTGCA
 
. : . : . : . : . : . :
JMFF032A18- GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
JMFF025D19- GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
JMFF035D14- GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
JMFF015H10- GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
JMFF011G10- GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
JMSF036A04- GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
rJMFF019N14+ GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
rJMFF015H10+ GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
rJMFF032A18+ GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
rJMFF035D14+ GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
rJMSF036A04+ GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
rJMSF042L08+ GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
rJMFF025D19+ GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
rJMFF011G10+ GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
                      ____________________________________________________________
consensus GAGGGGCCTGATTGCAGAGATAATATCCCGTTTTGAGCGCAAGGGTTTCAAACTTGTTGG
 
. : . : . : . : . : . :
JMFF032A18- AATAAAAATTTTGGTAC
JMFF025D19- AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
JMFF035D14- AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
JMFF015H10- AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
JMFF011G10- AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
JMSF036A04- AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
rJMFF019N14+ AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
rJMFF015H10+ AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
rJMFF032A18+ AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
rJMFF035D14+ AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
rJMSF036A04+ AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
rJMSF042L08+ AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
rJMFF025D19+ AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
rJMFF011G10+ AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
                      ____________________________________________________________
consensus AATAAAAATTTTGGTACCTTCCAAGGACTTTGCCCAGAAGCATTATCATGATCTCAAGGA
 
. : . : . : . : . : . :
JMFF025D19- AAGACCTTTCTTC
JMFF035D14- AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGC
JMFF015H10- AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCT
JMFF011G10- AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
JMSF036A04- AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
rJMFF019N14+ AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
rJMFF015H10+ AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
rJMFF032A18+ AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
rJMFF035D14+ AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
rJMSF036A04+ AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
rJMSF042L08+ AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
rJMFF025D19+ AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
rJMFF011G10+ AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
                      ____________________________________________________________
consensus AAGACCTTTCTTCAATGGTTTATGCGACTTCCTTAGCTCTGGCCCTGTTATTGGAATGGT
 
. : . : . : . : . : . :
JMFF011G10- TTGGGAAGGTGAANGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCAC
JMSF036A04- TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCACAGATCCACA
rJMFF019N14+ TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCACAGATCCACA
rJMFF015H10+ TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCACAGATCCACA
rJMFF032A18+ TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCACAGATCCACA
rJMFF035D14+ TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCGCAGATCCACA
rJMSF036A04+ TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCACAGATCCACA
rJMSF042L08+ TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCACAGATCCACA
rJMFF025D19+ TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCACAGATCCACA
rJMFF011G10+ TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCACAGATCCACA
                      ____________________________________________________________
consensus TTGGGAAGGTGAAGGTGTGATAAAATATGGTCGTAAGCTTATTGGAGCCACAGATCCACA
 
. : . : . : . : . : . :
JMSF036A04- AAAATCTGAACCCGGAACTATCAGAAGTGACTTAGCCGTTGTAGTTGGAAGGAATATCAT
rJMFF019N14+ AAAATCTGAACCCGGAACTATCAGAGGTGACTTAGCCGTTGTAGTTGGAAGGAATATCAT
rJMFF015H10+ AAAATCTGAACCCGGAACTATCAGAGGTGACTTAGCCGTTGTAGTTGGAAGGAATATCAT
rJMFF032A18+ AAAATCTGAACCCGGAACTATCAGAGGTGACTTAGCCGTTGTAGTTGGAAGGAATATCAT
rJMFF035D14+ AAAATCTGAACCCGGAACTATCAGAGGTGACTTAGCTGTTGTAGTTGGAAGGAATATCAT
rJMSF036A04+ AAAATCTGAACCCGGAACTATCAGAGGTGACTTAGCCGTTGTAGTTGGAAGGAATATCAT
rJMSF042L08+ AAAATCTGAACCCGGAACTATCAGAGGTGACTTAGCCGTTGTAGTTGGAAGGAATATCAT
rJMFF025D19+ AAAATCTGAACCCGGAACTATCAGAGGTGACTTAGCCGTTGTAGTTGGAAGGAATATCAT
rJMFF011G10+ AAAATCTGAACCCGGAACTATCAGAGGTGACTTAGCCGTTGTAGTTGGAAGGAATATCAT
                      ____________________________________________________________
consensus AAAATCTGAACCCGGAACTATCAGAGGTGACTTAGCCGTTGTAGTTGGAAGGAATATCAT
 
. : . : . : . : . : . :
JMSF036A04- CCATGGTAGCGAT
rJMFF019N14+ CCATGGTAGCGATGGCCCTGAGACTGCAAAGGATGAAATCGCCCTATGGTTCAAACCAGA
rJMFF015H10+ CCATGGTAGCGATGGCCCTGAGACTGCAAAGGATGAAATCGCCCTATGGTTCAAACCAGA
rJMFF032A18+ CCATGGTAGCGATGGCCCTGAGACTGCAAAGGATGAAATCGCCCTATGGTTCAAACCAGA
rJMFF035D14+ CCATGGTAGCGATGGCCCTGAGACTGCAAAGGATGAAATCGCCCTATGGTTCAAACCAGA
rJMSF036A04+ CCATGGTAGCGATGGCCCTGAGACTGCAAAGGATGAAATCGCCCTATGGTTCAAACCAGA
rJMSF042L08+ CCATGGTAGCGATGGCCCTGAGACTGCAAAGGATGAAATCGCCCTATGGTTCAAACCAGA
rJMFF025D19+ CCATGGTAGCGATGGCCCTGAGACTGCAAAGGATGAAATCGCCCTATGGTTCAAACCAGA
rJMFF011G10+ CCATGGTAGCGATGGCCCTGAGACTGCAAAGGATGAAATCGCCCTATGGTTCAAACCAGA
                      ____________________________________________________________
consensus CCATGGTAGCGATGGCCCTGAGACTGCAAAGGATGAAATCGCCCTATGGTTCAAACCAGA
 
. : . : . : . : . : . :
rJMFF019N14+ AGAGTTGGTAAATTACACGAATAATGCAGAGAAGTGGATATATGGTGATAACTGACCAAC
rJMFF015H10+ AGAGTTGGTAAATTACACGAATAATGCAGAGAAGTGGATATATGGTGATAACTGACCAAC
rJMFF032A18+ AGAGTTGGTAAATTACACGAATAATGCAGAGAAGTGGATATATGGTGATAACTGACCAAC
rJMFF035D14+ AGGGTTGGTAAATTACACGAATAATGCAGAGAAGTGGATATATGGTGATAACTGACCAAC
rJMSF036A04+ AGAGTTGGTAAATTACACGAATAATGCAGAGAAGTGGATATATGGTGATAACTGACCAAC
rJMSF042L08+ AGAGTTGGTAAATTACACGAATAATGCAGAGAAGTGGATATATGGTGATAACTGACCAAC
rJMFF025D19+ AGAGTTGGTAAATTACACGAATAATGCAGAGAAGTGGATATATGGTGATAACTGACCAAC
rJMFF011G10+ AGAGTTGGTAAATTACACGAATAATGCAGAGAAGTGGATATATGGTGATAACTGACCAAC
                      ____________________________________________________________
consensus AGAGTTGGTAAATTACACGAATAATGCAGAGAAGTGGATATATGGTGATAACTGACCAAC
 
. : . : . : . : . : . :
rJMFF019N14+ ACATTTTCTTTAACTAGAGCAGCAAACAATTCACATTCACTTCCAAAATTACTATAAAGA
rJMFF015H10+ ACATTTTCTTTAACTAGAGCAGCAAACAATTCACATTCACTTCCAAAATTACTATAAAGA
rJMFF032A18+ ACATTTTCTTTAACTAGAGCAGCAAACAATTCACATTCACTTCCAAAATTACTATAAAGA
rJMFF035D14+ ACATTTTCTTTAACTAGAGCAGCAAACAATTCACATTCACTTCCAAAATTACTATAAAGA
rJMSF036A04+ ACATTTTCTTTAACTAGAGCAGCAAACAATTCACATTCACTTCCAAAATTACTATAAAGA
rJMSF042L08+ ACATTTTCTTTAACTAGAGCAGCAAACAATTCACATTCACTTCCAAAATTACTATAAAGA
rJMFF025D19+ ACATTTTCTTTAACTAGAGCAGCAAACAATTCACATTCACTTCCAAAATTACTATAAAGA
rJMFF011G10+ ACATTTTCTTTAACTAGAGCAGCAAACAATTCACATTCACTTCCAAAATTACTATAAAGA
                      ____________________________________________________________
consensus ACATTTTCTTTAACTAGAGCAGCAAACAATTCACATTCACTTCCAAAATTACTATAAAGA
 
. : . : . : . : . : . :
rJMFF019N14+ GTGGAAGACGCATAATTATCAAAATAATATGTTTCGTTAAGTTGGGGAAGAACATTTCTC
rJMFF015H10+ GTGGAAGACGCATAATTATCAAAATAATATGTTTCGTTAAGTTGGGGAAGAACATTTCTC
rJMFF032A18+ GTGGAAGACGCATAATTATCAAAATAATATGTTTCGTTAAGTTGGGGAAGAACATTTCTC
rJMFF035D14+ GTGGAAGACGCATAATTATCAAAATAATATGTTTCGTTAAGTTGGGGAAGAACATTTCTC
rJMSF036A04+ GTGGAAGACGCATAATTATCAAAATAATATGTTTCGTTAAGTTGGGGAAGAACATTTCTC
rJMSF042L08+ GTGGAAGACGCATAATTATCAAAATAATATGTTTCGTTAAGTTGGGGAAGAACATTTCTC
rJMFF025D19+ GTGGAAGACGCATAATTATCAAAATAATATGTTTCGTTAAGTTGGGGAAGAACATTTCTC
rJMFF011G10+ GTGGAAGACGCATAATTATCAAAATAATATGTTTCGTTAAGTTGGGGAAGAACATTTCTC
                      ____________________________________________________________
consensus GTGGAAGACGCATAATTATCAAAATAATATGTTTCGTTAAGTTGGGGAAGAACATTTCTC
 
. : . : . : . : . : . :
rJMFF019N14+ CCTTCAAACTATTATTTACTTATTGTTTGGAACTATGTCATCCTTCCAATAATAC
rJMFF015H10+ CCTTCAAACTATTATTTACTTAT
rJMFF032A18+ CCTTCAAACTATTATTTACTTATTGTTTGGAACTATGTCATCCTTCCAATAATACA
rJMFF035D14+ CCTTCAAACTATTATTTACTTATTGTTTGGAACTATGTCATCCTTCCAATAATACA
rJMSF036A04+ CCTTCAAACTATTATTTACTTA
rJMSF042L08+ CCTTCAAACTATTATTTACTTATTG-TTGGAACTATG
rJMFF025D19+ CCTTCAAACTATTATTTACTTATTGTTTGGAACTATGTCATCCTTCCAATAATACA
rJMFF011G10+ CCTTCAAACTATTATTTACTTATTGTTTGGAACTATGTCATCCTTCCAATAATACATATA
                      ____________________________________________________________
consensus CCTTCAAACTATTATTTACTTATTGTTTGGAACTATGTCATCCTTCCAATAATACATATA