Previous Contig 008695:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011C15Sequence516000581 (2)gb:AY662343_16204640.012Solanum tuberosum 9-cis-epoxy-carotenoid dioxygenase 2 mRNA, complete cds.716008695 (2)gb:AY337614_16004234e-72Vitis vinifera 9-cis-epoxycarotenoid dioxygenase 2 (NCED2) mRNA, complete cds.
JMFN031G22Sequence381008695 (2)gb:AY662343_16204648e-25Solanum tuberosum 9-cis-epoxy-carotenoid dioxygenase 2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN031G22+ GGTCATGAACAGAATTT
rJMFF011C15- TATTATTTGTTAAAAGGATATACATACATGCAACTGTTTGGTCATGAACAGAATTT
                      ____________________________________________________________
consensus TATTATTTGTTAAAAGGATATACATACATGCAACTGTTTGGTCATGAACAGAATTT
 
. : . : . : . : . : . :
JMFN031G22+ ACAGAAACCAACGAACTGAGCTGCAAACTGCAACCTATTACACCTAACTACAATAAGCTT
rJMFF011C15- ACAGAAACCAACGAACTGAGCTGCAAACTGCAACCTATTACACCTAACTACAATAAGCTT
                      ____________________________________________________________
consensus ACAGAAACCAACGAACTGAGCTGCAAACTGCAACCTATTACACCTAACTACAATAAGCTT
 
. : . : . : . : . : . :
JMFN031G22+ CATGCATGCGTGATTCCTTAAAACTCCAAAACTAAATCACAATACCTCCTAGATTCTGTG
rJMFF011C15- CATGNGTGCGTGATTCCTTAAAACTCCAAAACTAAATCACAATACCTCCTAGATTCTGTG
                      ____________________________________________________________
consensus CATGCGTGCGTGATTCCTTAAAACTCCAAAACTAAATCACAATACCTCCTAGATTCTGTG
 
. : . : . : . : . : . :
JMFN031G22+ TCCATAATCTATCGCCCAGGAACAAACTGATAATAGTAAGGAGATATGTCATACTTGATT
rJMFF011C15- TCCATAATCTATCGCCCAGGAACAAACTGATAATAGTAAGGAGATATGTCATACTTGATT
                      ____________________________________________________________
consensus TCCATAATCTATCGCCCAGGAACAAACTGATAATAGTAAGGAGATATGTCATACTTGATT
 
. : . : . : . : . : . :
JMFN031G22+ TTGCAGGTCGTATGAAGTGATGAAAGTCCCATGAAAGCCATAGGGCACTCTTGAAGGAAG
rJMFF011C15- TTGCAGGTCGTATGAAGTGATGAAAGTCCCATGAAAGCCATAGGGCACTCTTGAAGGAAG
                      ____________________________________________________________
consensus TTGCAGGTCGTATGAAGTGATGAAAGTCCCATGAAAGCCATAGGGCACTCTTGAAGGAAG
 
. : . : . : . : . : . :
JMFN031G22+ CTTGATGGTGGCCAACAACTCCAAGTTAATGGCATTCACAATTTGCAGCTCAGATTTCCA
rJMFF011C15- CTTGATGGTGGCCAACAACTCCAAGTTAATGGCATTCACAATTTGCAGCTCAGATTTCCA
                      ____________________________________________________________
consensus CTTGATGGTGGCCAACAACTCCAAGTTAATGGCATTCACAATTTGCAGCTCAGATTTCCA
 
. : . : . : . : . : . :
JMFN031G22+ TGTCTTCTCGTCATGTACAAATGAAAGAATGTGTCCATCGTCTTCCTTCTCTGAATTCGG
rJMFF011C15- TGTCTTCTCGTCATGTACAAATGAAAGAATGTGTCCATCGTCTTCCTTCTCTGAATTCGG
                      ____________________________________________________________
consensus TGTCTTCTCGTCATGTACAAATGAAAGAATGTGTCCATCGTCTTCCTTCTCTGAATTCGG
 
. : . : . : . : . : . :
JMFN031G22+ ATTC
rJMFF011C15- ATTCCTGGGCACGAAAAATGGCTCTCCTCCATATTTCCCATCTCCATACATAAACTTCTG
                      ____________________________________________________________
consensus ATTCCTGGGCACGAAAAATGGCTCTCCTCCATATTTCCCATCTCCATACATAAACTTCTG
 
. : . : . : . : . : . :
rJMFF011C15- CATTTCTCCGGTTGAGAGGTCCACTTTAGCAAAACCAGAAACTTTAGGCCATGGCTCCGC
                      ____________________________________________________________
consensus CATTTCTCCGGTTGAGAGGTCCACTTTAGCAAAACCAGAAACTTTAGGCCATGGCTCCGC
 
. : . : . : . : . : . :
rJMFF011C15- AATCGCAAGATATGCATACTGGGTTTTCCGGCCCAGCAGGTTCCGGTTCACCATTCCGGC
                      ____________________________________________________________
consensus AATCGCAAGATATGCATACTGGGTTTTCCGGCCCAGCAGGTTCCGGTTCACCATTCCGGC
 
. : . : . : . : . : . :
rJMFF011C15- TTCTAAGTTCACCTGCTGATCTGTAGCCGGAATAATTGGCCTCTTCGTCGACTCCCCGGT
                      ____________________________________________________________
consensus TTCTAAGTTCACCTGCTGATCTGTAGCCGGAATAATTGGCCTCTTCGTCGACTCCCCGGT
 
. : . : . : . : . : . :
rJMFF011C15- TTTCAGATTTAGCCGGATTTCCGATAGGATGCTCTTCAGATTCTCTTCGCATTCGTTGAA
                      ____________________________________________________________
consensus TTTCAGATTTAGCCGGATTTCCGATAGGATGCTCTTCAGATTCTCTTCGCATTCGTTGAA