Previous Contig 008691:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011A21Sequence570008691 (8)gb:AY484391_11784092e-81Capsicum annuum mary storys protein mRNA, complete cds.>gb:AY484392_1178410 Caps637008691 (8)gb:AY484391_11784091e-49Capsicum annuum mary storys protein mRNA, complete cds.>gb:AY484392_1178410 Caps
JMFF019J14Sequence576008691 (8)gb:AY484391_11784092e-81Capsicum annuum mary storys protein mRNA, complete cds.>gb:AY484392_1178410 Caps748008691 (8)gb:AY484391_11784094e-81Capsicum annuum mary storys protein mRNA, complete cds.>gb:AY484392_1178410 Caps
JMFF040D10Sequence559008691 (8)gb:AY484391_11784092e-81Capsicum annuum mary storys protein mRNA, complete cds.>gb:AY484392_1178410 Caps661008691 (8)gb:AY484391_11784091e-60Capsicum annuum mary storys protein mRNA, complete cds.>gb:AY484392_1178410 Caps
JMFF049B20Sequence616008691 (8)gb:AY484391_11784092e-81Capsicum annuum mary storys protein mRNA, complete cds.>gb:AY484392_1178410 Caps583008691 (8)gb:AY484391_11784096e-44Capsicum annuum mary storys protein mRNA, complete cds.>gb:AY484392_1178410 Caps

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040D10- GACATGTTGTAGAGAGAAAGCTATCGG
JMFF049B20- GACATGTTGTAGAGAGAAAGCTATCGG
                      ____________________________________________________________
consensus GACATGTTGTAGAGAGAAAGCTATCGG
 
. : . : . : . : . : . :
JMFF040D10- CCATGTCTGACGAGCACCATTTCGAGTCGAAGGCAGATGCAGGGGCATCCAAGACCTTCC
JMFF049B20- CCATGTCTGACGAGCACCATTTCGAGTCGAAGGCAGATGCAGGGGCATCCAAGACCTTCC
JMFF019J14- GAGCACCATTTCGAGTCGAAGGCAGATGCAGGGGCATCCAAGACCTTCC
JMFF011A21- GAGCACCATTTCGAGTCGAAGGCAGATGCAGGGGCATCCAAGACCTTCC
rJMFF019J14+ CTGACGAGCACCATTTCGAGTCGAAGGCAGATGCAGGGGCATCCAAGACCTTCC
                      ____________________________________________________________
consensus CCATGTCTGACGAGCACCATTTCGAGTCGAAGGCAGATGCAGGGGCATCCAAGACCTTCC
 
. : . : . : . : . : . :
JMFF040D10- CGCAGCAAGCTGGTACCATCCGAAAGAATGGCTACCTAGTCATCAAATCTCGCCCTTGCA
JMFF049B20- CGCAGCAAGCTGGTACCATCCGAAAGAATGGCTACCTAGTCATCAAATCTCGCCCTTGCA
rJMFF040D10+ CGAAAGAATGGCTACCTAGTCATCAAATCTCGCCCTNGCA
JMFF019J14- CGCAGCAAGCTGGTACCATCCGAAAGAATGGCTACCTAGTCATCAAATCTCGCCCTTGCA
JMFF011A21- CGCAGCAAGCTGGTACCATCCGAAAGAATGGCTACCTAGTCATCAAATCTCGCCCTTGCA
rJMFF019J14+ CGCAGCAAGCTGGTACCATCCGAAAGAATGGCTACCTAGTCATCAAATCTCGCCCTTGCA
                      ____________________________________________________________
consensus CGCAGCAAGCTGGTACCATCCGAAAGAATGGCTACCTAGTCATCAAATCTCGCCCTTGCA
 
. : . : . : . : . : . :
JMFF040D10- AGGTTGTTGAGGTCTCCACTTCAAAAACCGGCAAGCATGGGCATGCTAAGTGTCACTTTG
JMFF049B20- AGGTTGTTGAGGTCTCCACTTCAAAAACCGGCAAGCATGGGCATGCTAAGTGTCACTTTG
rJMFF040D10+ AGGTTGTTGAGGTCTCCACNTCAAAAACCGGCAAGCATGGGCATGCTAAGTGTCACNTTG
JMFF019J14- AGGTTGTTGAGGTCTCCACTTCAAAAACCGGCAAGCATGGGCATGCTAAGTGTCACTTTG
JMFF011A21- AGGTTGTTGAGGTCTCCACTTCAAAAACCGGCAAGCATGGGCATGCTAAGTGTCACTTTG
rJMFF019J14+ AGGTTGTTGAGGTCTCCACTTCAAAAACCGGCAAGCATGGGCATGCTAAGTGTCACTTTG
rJMFF011A21+ AAAAACCGGCAAGCATGGGCATGCTAAGTGTCACTNTG
                      ____________________________________________________________
consensus AGGTTGTTGAGGTCTCCACTTCAAAAACCGGCAAGCATGGGCATGCTAAGTGTCACTTTG
 
. : . : . : . : . : . :
JMFF040D10- TGGCAATTGATATTTTCAATGGGAAGAAACTTGAAGATATTGTTCCTTCTTCTCACAATT
JMFF049B20- TGGCAATTGATATTTTCAATGGGAAGAAACTTGAAGATATTGTTCCTTCTTCTCACAATT
rJMFF040D10+ TGGCAANTGATATTTTCAATGGGAAGAAACTTGAAGATATTGTTCCTTCTTCTCACAATT
JMFF019J14- TGGCAATTGATATTTTCAATGGGAAGAAACTTGAAGATATTGTTCCTTCTTCTCACAATT
JMFF011A21- TGGCAATTGATATTTTCAATGGGAAGAAACTTGAAGATATTGTTCCTTCTTCTCACAATT
rJMFF019J14+ TGGCAATTGATATTTTCAATGGGAAGAAACTTGAAGATATTGTTCCTTCTTCTCACAATT
rJMFF049B20+ TTTCAATGGGAAGAAACTGNAAGATATTGTTCCTTCTTCTCACAATT
rJMFF011A21+ TGGCAATNGATATTTTCAATGGGAAGAAACTTGAAGATATTGTTCCTTCTTNTCACAATT
                      ____________________________________________________________
consensus TGGCAATTGATATTTTCAATGGGAAGAAACTTGAAGATATTGTTCCTTCTTCTCACAATT
 
. : . : . : . : . : . :
JMFF040D10- GTGATGTTCCTCATGTTAATCGCACCGACTACCAGCTGATTGACATCTCTGAAGATGGTT
JMFF049B20- GTGATGTTCCTCATGTTAATCGCACCGACTACCAGCTGATTGACATCTCTGAAGATGGTT
rJMFF040D10+ GTGATGTTCCTCATGTTAATCGCNCCGACTACCAGCTGATTGACATCTNTGAAGATGGTT
JMFF019J14- GTGATGTTCCTCATGTTAATCGCACCGACTACCAGCTGATTGACATCTCGGAAGATGGTT
JMFF011A21- GTGATGTTCCTCATGTTAATCGCACCGACTACCAGCTGATTGACATCTCGGAAGATGGTT
rJMFF019J14+ GTGATGTTCCTCATGTTAATCGCACCGACTACCAGCTGATTGACATCTCGGAAGATGGTT
rJMFF049B20+ GTGATGTTCCTCATGTTAATCGCACCGACTACCAGCTGATTGACATCTCTGAAGATGGTT
rJMFF011A21+ GTGATGTTCCTCATGTTAATCGCNCCGACTACCAGCTGATTGACATCTCGGAAGATGGTT
                      ____________________________________________________________
consensus GTGATGTTCCTCATGTTAATCGCACCGACTACCAGCTGATTGACATCTCTGAAGATGGTT
 
. : . : . : . : . : . :
JMFF040D10- TTGTGTCTCTTCTTACCGAAAACGGGAACACCAAAGATGACTTGAGGCTTCCCACCGATG
JMFF049B20- TTGTGTCTCTTCTTACCGAAAACGGGAACACCAAAGATGACTTGAGGCTTCCCACCGATG
rJMFF040D10+ TTGTGTCTNTTCTTACCGAAAACGGGAACACCAAAGATGACTTGAGGCTTCCCNCCGATG
JMFF019J14- TTGTGTCTCTTCTTACCGAAAACGGGAACACCAAAGATGACTTGAGGCTTCCCACCGATG
JMFF011A21- TTGTGTCTCTTCTTACCGAAAACGGGAACACCAAAGATGACTTGAGGCTTCCCACCGATG
rJMFF019J14+ TTGTGTCTCTTCTTACCGAAAACGGGAACACCAAAGATGACTTGAGGCTTCCCACCGATG
rJMFF049B20+ TTGTGTCTCTTCTTACCGAAAACGGGAACACCAAAGATGACTTGAGGCTTCCCACCGATG
rJMFF011A21+ TNGTGTCTCTTNTTNCCGAAAACGGGAACACCAAAGATGACTTGAGGCTTCCCNCCGATG
                      ____________________________________________________________
consensus TTGTGTCTCTTCTTACCGAAAACGGGAACACCAAAGATGACTTGAGGCTTCCCACCGATG
 
. : . : . : . : . : . :
JMFF040D10- AAGCTCTGCTTGGCCAGATTAAAGGTGGATTTGATGAAGGAAAGGATCTTATTTTGACTG
JMFF049B20- AAGCTCTGCTTGGCCAGATTAAAGGTGGATTTGATGAAGGAAAGGATCTTATTTTGACTG
rJMFF040D10+ AAGCTNTGCTTGGCCAGATTAAAGGTGGATTTGATGAAGGAAAGGATCTTATTTTGACTG
JMFF019J14- AAGCTCTGCTTGGCCAGATTAAAGGTGGATTTGATGAAGGAAAGGATCTTATTTTGACTG
JMFF011A21- AAGCTCTGCTTGGCCAGATTAAAGGTGGATTTGATGAAGGAAAGGATCTTATTTTGACTG
rJMFF019J14+ AAGCTCTGCTTGGCCAGATTAAAGGTGGATTTGATGAAGGAAAGGATCTTATTTTGACTG
rJMFF049B20+ AAGCTCTGCTTGGCCAGATTAAAGGTGGATTTGATGAAGGAAAGGATCTTATTTTGACTG
rJMFF011A21+ AAGCTNTGNTTGGCCAGATTAAAGGTGGATTTGATGAAGGAAAGGATCTTATTTTGACTG
                      ____________________________________________________________
consensus AAGCTCTGCTTGGCCAGATTAAAGGTGGATTTGATGAAGGAAAGGATCTTATTTTGACTG
 
. : . : . : . : . : . :
JMFF040D10- TTATGTCTGCAATGGGAGAAGAGCAGATTTGTACGGTGAAAGACATTGGTAAAACTAATT
JMFF049B20- TTATGTCTGCAATGGGAGAAGAGCAGATTTGTACGGTGAAAGACATTGGTAAAACTAATT
rJMFF040D10+ TTATGTCTGCAANGGGAGAAGAGCAGATTTGTACGGTGAAAGACATNGGTAAAACTAATT
JMFF019J14- TTATGTCTGCAATGGGAGAAGAGCAGATTTGTACGGTGAAAGACATTGGTAAAACTAATT
JMFF011A21- TTATGTCTGCAATGGGAGAAGAGCAGATTTGTACGGTGAAAGACATTGGTAAAACTAATT
rJMFF019J14+ TTATGTCTGCAATGGGAGAAGAGCAGATTTGTACGGTGAAAGACATTGGTAAAACTAATT
rJMFF049B20+ TTATGTCTGCAATGGGAGAAGAGCAGATTTGTACGGTGAAAGACATTGGTAAAACTAATT
rJMFF011A21+ TTATGTCTGCAATGGGAGAAGAGCAGATTTGTACGGTGAAAGACATTGGTAAAACTAATT
                      ____________________________________________________________
consensus TTATGTCTGCAATGGGAGAAGAGCAGATTTGTACGGTGAAAGACATTGGTAAAACTAATT
 
. : . : . : . : . : . :
JMFF040D10- AAGTCGCATGATTTCCAACCCTATCGAAAGCATATCTCTCAAGCGAACCGTT
JMFF049B20- AAGTCGCATGATTTCCAACCCTATCGAAAGCATATCTCTCAAGCGAACCGTTCTCAGAAG
rJMFF040D10+ AAGTCGCATGATTTCCAACCCTATNGAAAGCATATCTNTCAAGCGAACCGTTCTCAGAAG
JMFF019J14- AAGTCGCATGATTTCCAACCCTATCGAAAGCATATCTCTCAAGCGAAC
JMFF011A21- AAGTCGCATGATTTCCAACCCTATCNAAAGCATATCTCTCAAGC
rJMFF019J14+ AAGTCGCATGATTTCCAACCCTATCGAAAGCATATCTCTCAAGCGAACCGTTCTCAGAAG
rJMFF049B20+ AAGTCGCATGATTTCCAACCCTATCGAAAGCATATCTCTCAAGCGAACCGTTCTCAGAAG
rJMFF011A21+ AAGTCGCATGATTTCCAACCCTATCGAAAGCATATCTCTCAAGCGAACCGTTCTCAGAAG
                      ____________________________________________________________
consensus AAGTCGCATGATTTCCAACCCTATCGAAAGCATATCTCTCAAGCGAACCGTTCTCAGAAG
 
. : . : . : . : . : . :
JMFF049B20- AAAGTTTAGCTTCATATCTCTTAAGCGAACCGTTCCCCTAAGAAAGTTT
rJMFF040D10+ AAAGTTTAGCTTCATATCTNTTAAGCGAACCGTTCCCTAAAGAAAGTTTAGCGAGACAGN
rJMFF019J14+ AAAGTTTAGCTTCATATCTCTTAAGCGAACCGTTCCCTAAAGAAAGTTTAGCGAGACAGT
rJMFF049B20+ AAAGTTTAGCTTCATATCTCTTAAGCGAACCGTTCCCTAAAGAAAGTTTAGCGAGACAGT
rJMFF011A21+ AAAGTTTAGCTTCATATCTCTTAAGCGAACCGTTCCCTAAAGAAAGTTTAGCGAGACAGT
                      ____________________________________________________________
consensus AAAGTTTAGCTTCATATCTCTTAAGCGAACCGTTCCCTAAAGAAAGTTTAGCGAGACAGT
 
. : . : . : . : . : . :
rJMFF040D10+ GAGCTTGAGATTTGCAGCAGCAGGGATGGAGATTTTACTCTTTTTGGTTATGTTTTATTT
rJMFF019J14+ GAGCTTGAGATTTGCAGCAGCAGGGATGGAGATTTTACTCTTTTTGGTTATGTTTTATTT
rJMFF049B20+ GAGCTTGAGATTTGCAGCAGCAGGGATGGAGATTTTACTCTTTTTGGTTATGTTTTATTT
rJMFF011A21+ GAGCTTGAGATTTGCAGCAGCAGGGATGGAGATTTTACTCTTTTTGGTTATGTTTTATTT
                      ____________________________________________________________
consensus GAGCTTGAGATTTGCAGCAGCAGGGATGGAGATTTTACTCTTTTTGGTTATGTTTTATTT
 
. : . : . : . : . : . :
rJMFF040D10+ CTGTGCTCAACTGTTGCAANTTTTTTTTGGTGAGGAAAGAGAGGNTGAGCCTCAACTATC
rJMFF019J14+ CTGTGCTCAACTGTTGCAA-TTTTTTTTGGTGAGGAAAGAGAGGTTGAGCCTCAACTATC
rJMFF049B20+ CTGTGCTCAACTGTTGCAATTTTTTTTTGGTGAGGAAAGAGAGGTTGAGCCTCAACTATC
rJMFF011A21+ CTGTGCTCAACTGTTGCAA-TTTTTTTTGGTGAGGAAAGAGAGGTTGAGCCTCAACTATC
                      ____________________________________________________________
consensus CTGTGCTCAACTGTTGCAATTTTTTTTTGGTGAGGAAAGAGAGGTTGAGCCTCAACTATC
 
. : . : . : . : . : . :
rJMFF040D10+ TAACTCNGCAGCNAAATTCAA
rJMFF019J14+ TAACTCTGCAGTTAAATTCAATCTTATGTGCA
rJMFF049B20+ TAACTCTGCAGTTAAATTCAATCTTATGTGCATGATTCCTTCCTTCCCTTATGAAG
rJMFF011A21+ TAACTCTGCAGTNAAATTCAATCTTATGTGCATGATTCCTTCCTTCCCTTATGAAGAAAA
                      ____________________________________________________________
consensus TAACTCTGCAGTTAAATTCAATCTTATGTGCATGATTCCTTCCTTCCCTTATGAAGAAAA