Previous Contig 008687:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011A03Sequence522008687 (2)pir|T52461|T524616e-35RNA binding protein [imported] - Arabidopsis thaliana>gb:AB008022_1510346 Arabid806008687 (2)pir|T52461|T524615e-23RNA binding protein [imported] - Arabidopsis thaliana>gb:AB008022_1510346 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011A03- CTTTACAGGCGTTGCGTT
                      ____________________________________________________________
consensus CTTTACAGGCGTTGCGTT
 
. : . : . : . : . : . :
JMFF011A03- TGGGCAATGCAGGATTCGGACAGAAGCAAGCTGTTTGTGGGAGGGGTTTCCCGGCAGACT
                      ____________________________________________________________
consensus TGGGCAATGCAGGATTCGGACAGAAGCAAGCTGTTTGTGGGAGGGGTTTCCCGGCAGACT
 
. : . : . : . : . : . :
JMFF011A03- ACCGACGAGACCCTCAGGGAACACTTCTCTAAGTACGGAACCGTGGTTAGCGCTGCTATC
                      ____________________________________________________________
consensus ACCGACGAGACCCTCAGGGAACACTTCTCTAAGTACGGAACCGTGGTTAGCGCTGCTATC
 
. : . : . : . : . : . :
JMFF011A03- GCCAAGGATGGAATTACCGGCAACCCTCGAGGGTTCGCCTTCGTCTCCTTCACCGAACCC
                      ____________________________________________________________
consensus GCCAAGGATGGAATTACCGGCAACCCTCGAGGGTTCGCCTTCGTCTCCTTCACCGAACCC
 
. : . : . : . : . : . :
JMFF011A03- TCCGCCGTTGATAATGCCCTCCGAGATACCCATGAAATCCTCGGAAGAACGGTAGAGGTG
                      ____________________________________________________________
consensus TCCGCCGTTGATAATGCCCTCCGAGATACCCATGAAATCCTCGGAAGAACGGTAGAGGTG
 
. : . : . : . : . : . :
JMFF011A03- AAAAAAGCAATACCTAGAAGTGAACAAGAACAAAGAGAACAACATAGTAGGCAGGGGTTG
                      ____________________________________________________________
consensus AAAAAAGCAATACCTAGAAGTGAACAAGAACAAAGAGAACAACATAGTAGGCAGGGGTTG
 
. : . : . : . : . : . :
JMFF011A03- AGTAGGAGTAGTAGGACTAGCGGTAGGAGCGATAACCAGTTTAGCACAAAAAAGATTTTT
                      ____________________________________________________________
consensus AGTAGGAGTAGTAGGACTAGCGGTAGGAGCGATAACCAGTTTAGCACAAAAAAGATTTTT
 
. : . : . : . : . : . :
JMFF011A03- GTCGGGGGGTTATCAGCTACTCTAACTGAGGAAGAGTTCAAGGG-TTATTTCGAAAGGTT
rJMFF011A03+ GAGTTCAAGGGTTTATTTCGAAAGGTT
                      ____________________________________________________________
consensus GTCGGGGGGTTATCAGCTACTCTAACTGAGGAAGAGTTCAAGGGTTTATTTCGAAAGGTT
 
. : . : . : . : . : . :
JMFF011A03- TGGTAGGATCATGGGACGTAGTTGTGATGCACGACAACGTGACCCATAAGCCACGGGGAT
rJMFF011A03+ TGGTAGGATCAT-GGACGTAGTTGTGATGCACGACAACGTGACCCATAAGCCACGGGGAT
                      ____________________________________________________________
consensus TGGTAGGATCATGGGACGTAGTTGTGATGCACGACAACGTGACCCATAAGCCACGGGGAT
 
. : . : . : . : . : . :
JMFF011A03- TTGGGTTTATTACTTTTAGTTCAGA
rJMFF011A03+ TTGGGTTTATTACTTTTAGTTCAGAGGACGCTGTTGAACAAGTTACACAGAAGAATTTCC
                      ____________________________________________________________
consensus TTGGGTTTATTACTTTTAGTTCAGAGGACGCTGTTGAACAAGTTACACAGAAGAATTTCC
 
. : . : . : . : . : . :
rJMFF011A03+ ATGAGTTGTGTGGTAAGCTTGTAGAGGTTAAGAGGGCTGTACCGAAAGATGGTAGTAGCA
                      ____________________________________________________________
consensus ATGAGTTGTGTGGTAAGCTTGTAGAGGTTAAGAGGGCTGTACCGAAAGATGGTAGTAGCA
 
. : . : . : . : . : . :
rJMFF011A03+ GTAGCAGTCACAGCCACTTTTATAATGGTAGTGGAAGGGGTGCTTCCTTTGAAAGTTACC
                      ____________________________________________________________
consensus GTAGCAGTCACAGCCACTTTTATAATGGTAGTGGAAGGGGTGCTTCCTTTGAAAGTTACC
 
. : . : . : . : . : . :
rJMFF011A03+ AGCACTTAATTTATCCACCTGTTAGTCCTAGTTACAGAGTTTTCCCCAGTTATGGACCTA
                      ____________________________________________________________
consensus AGCACTTAATTTATCCACCTGTTAGTCCTAGTTACAGAGTTTTCCCCAGTTATGGACCTA
 
. : . : . : . : . : . :
rJMFF011A03+ TTACGGGGTATGAAAGTGTTGCAGGGTATCCATATCAAGCTGGATTTATCGGCAGTGATT
                      ____________________________________________________________
consensus TTACGGGGTATGAAAGTGTTGCAGGGTATCCATATCAAGCTGGATTTATCGGCAGTGATT
 
. : . : . : . : . : . :
rJMFF011A03+ ACCCTGCTGGAACATACAGTGGATTTGTTTGTGGTGCTGCTCCTTTTGCACCTAGGGGTC
                      ____________________________________________________________
consensus ACCCTGCTGGAACATACAGTGGATTTGTTTGTGGTGCTGCTCCTTTTGCACCTAGGGGTC
 
. : . : . : . : . : . :
rJMFF011A03+ CTTGGATTGGCTCAGGAAGTTCATTACCTTATGGCGGTGCAACTATCTATCCTGCCTATT
                      ____________________________________________________________
consensus CTTGGATTGGCTCAGGAAGTTCATTACCTTATGGCGGTGCAACTATCTATCCTGCCTATT
 
. : . : . : . : . : . :
rJMFF011A03+ TGAACGGTGGAGTTGGAGTGATTGGCATGACTACTAGTGGATTTAATGGGTTTATGGGAA
                      ____________________________________________________________
consensus TGAACGGTGGAGTTGGAGTGATTGGCATGACTACTAGTGGATTTAATGGGTTTATGGGAA
 
. : . : . : . : . : . :
rJMFF011A03+ CTGGAATAAATGGGAAACCCGCTCAACCTGGAAGCACAGGGCGTATTTCATTCAACCCAC
                      ____________________________________________________________
consensus CTGGAATAAATGGGAAACCCGCTCAACCTGGAAGCACAGGGCGTATTTCATTCAACCCAC
 
. : . : . : . : . : . :
rJMFF011A03+ AGTCAGATTGGTAGAGGAAATGTACATATAAATTCTTTAGCTTCTGTTGGAAACTTAGGT
                      ____________________________________________________________
consensus AGTCAGATTGGTAGAGGAAATGTACATATAAATTCTTTAGCTTCTGTTGGAAACTTAGGT
 
. : . : . : . : . : . :
rJMFF011A03+ GTTGCTACTAGCAAACACATTCGACGAGGTAAAGAAATTCTGATTGGCTACCTTGTGACT
                      ____________________________________________________________
consensus GTTGCTACTAGCAAACACATTCGACGAGGTAAAGAAATTCTGATTGGCTACCTTGTGACT
 
. : . : . : . : . : . :
rJMFF011A03+ AGATGTAGATACAGTGATAGATTAGTAACTTTTCTGATTGAGGATATGTTGCTATTATTG
                      ____________________________________________________________
consensus AGATGTAGATACAGTGATAGATTAGTAACTTTTCTGATTGAGGATATGTTGCTATTATTG