Previous Contig 008685:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004G17Sequence577000198 (5)pir|A96828|A968282e-16hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895666008685 (5)
JMFF010P18Sequence544000198 (5)pir|A96828|A968281e-32hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895798008685 (5)pir|A96828|A968282e-12hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMSF022E23Sequence707000198 (5)pir|A96828|A968286e-62hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895123008685 (5)
JMSF025A16Sequence676000198 (5)pir|A96828|A968281e-43hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895772008685 (5)pir|A96828|A968289e-12hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895
JMSF028I24Sequence482000198 (5)pir|A96828|A968283e-27hypothetical protein F19K16.31 [imported] - Arabidopsis thaliana>gb:AE005173_895657008685 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025A16+ TCTTNAACGNTACACGCACAC
rJMFF010P18+ AACGTTACACGCACAC
                      ____________________________________________________________
consensus TCTTNAACGTTACACGCACAC
 
. : . : . : . : . : . :
rJMSF025A16+ NATTCGACNACCTCGGGACAGTCATTGTGATTAGGAGTTTATTGAGAGTCTTGCCGATAG
rJMFF010P18+ AATTCGACANCNTCGGGACAGTCATTGTGATTAGGAGTTTATTGAGAGTCTTGCCGATAG
                      ____________________________________________________________
consensus AATTCGACAACCTCGGGACAGTCATTGTGATTAGGAGTTTATTGAGAGTCTTGCCGATAG
 
. : . : . : . : . : . :
rJMSF028I24+ GACCCGAACGCTTCCATTCTCCCAACCGAAATGT
rJMSF025A16+ GGCTTTTGTTTTTGGTGCCCAGCAGTGACCCGAACGCTTCCATTCTCCCAACCGAAATGT
rJMFF004G17+ CCCAACNGAAATGT
rJMFF010P18+ GGCTTTTGTTTTTGGTGCCCAGCAGTGACCCGAACGCTTCCATTCTCCCAACCGAAATGT
                      ____________________________________________________________
consensus GGCTTTTGTTTTTGGTGCCCAGCAGTGACCCGAACGCTTCCATTCTCCCAACCGAAATGT
 
. : . : . : . : . : . :
rJMSF028I24+ TGCCAACTAAGAAGGGCGAAGATTCAGCGAAAACCGATAATATGGAAATGGCCGCGCTTA
rJMSF025A16+ TGCCAACTAAGAAGGGCGAAGATTCAGCGAAAACCGATAATATGGAAATGGCCGCGCTTA
rJMFF004G17+ TGCCAACTAAGAAGGGCGAAGATTCAGCGAAAACCGATAATATGGAAATGGCCGCGCTTA
rJMFF010P18+ TGCCAACTAAGAAGGGCGAAGATTCAGCGAAAACCGATAATATGGAAATGGCCGCGCTTA
                      ____________________________________________________________
consensus TGCCAACTAAGAAGGGCGAAGATTCAGCGAAAACCGATAATATGGAAATGGCCGCGCTTA
 
. : . : . : . : . : . :
rJMSF028I24+ TCAACCCAGTAGACCAGACTTTAGCCAAGGAATGAGCAAAAAAGAAGGCATGTTACTATC
rJMSF025A16+ TCAACCCAGTAGACCAGACTTTAGCCAAGGAATGAGCAAAAAAGAAGGCATGTTACTATC
rJMFF004G17+ TCAACCCAGTAGACCAGACTTTAGCCAAGGAATGAGCAAAAAAGGAGGCATGTTACTATC
rJMFF010P18+ TCAACCCAGTAGACCAGACTTTAGCCAAGGAATGAGCAAAAAAGAAGGCATGTTACTATC
                      ____________________________________________________________
consensus TCAACCCAGTAGACCAGACTTTAGCCAAGGAATGAGCAAAAAAGAAGGCATGTTACTATC
 
. : . : . : . : . : . :
rJMSF028I24+ ACCCGCAAGAAGAAAAAAGATTTCCAGGTTTTATAAGTGTCTGGAGAAGCATAAGATTAT
rJMSF025A16+ ACCCGCAAGAAGAAAAAAGATTTCCAGGTTTTATAAGTGTCTGGAGAAGCATAAGATTAT
rJMFF004G17+ ACCCGCAAGAAGAAAAAAGATTTCCAGGTTTTATAAGTGTCTGGAGAAGCATAAGATTAT
rJMFF010P18+ ACCCGCAAGAAGAAAAAAGATTTCCAGGTTTTATAAGTGTCTGGAGAAGCATAAGATTAT
                      ____________________________________________________________
consensus ACCCGCAAGAAGAAAAAAGATTTCCAGGTTTTATAAGTGTCTGGAGAAGCATAAGATTAT
 
. : . : . : . : . : . :
rJMSF028I24+ GCTCCGGAGATAGATCTCTACTAACTCTTCGGTAAGAAANTGGTGCCCGCTGATTCAGGT
rJMSF025A16+ GCTCCGGAGATAGATCTCTACTAACTCTTCGGTAAGAAATTGGTGCCCGCTGATTCAGGT
rJMFF004G17+ GCTCCGGAGATAGATCTCTACTAACTCTTCGGTAAGAAATTGGTGCCCGCTGATTCAGGT
rJMFF010P18+ GCTCCGGAGATAGATCTCTACTAACTCTTCGGTAAGAAATTGGTGCCCGCTGATTCAGGT
                      ____________________________________________________________
consensus GCTCCGGAGATAGATCTCTACTAACTCTTCGGTAAGAAATTGGTGCCCGCTGATTCAGGT
 
. : . : . : . : . : . :
rJMSF028I24+ TCTGATAAAGCTGGCTTTCTACAGTTTATACACATTTGTACAAATTCCATTCTCTCCGAT
rJMSF025A16+ TCTGATAAAGCTGGCTTTCTACAGTTTATACACATTTGTACAAATTCCATTCTCTCCGAT
rJMSF022E23+ CAGTTTATACACANTTGTACAAATTCCNTTCTNTCCGNT
rJMFF004G17+ TCTGATAAAGCTGGCTTTCTACAGTTTATACACATTTGTACAAATTCCATTCTCTCCGAT
rJMFF010P18+ TCTGATAAAGCTGGCTTTCTACATTTTATACACATTTGTACAAATTCCATTCTCTCCGAT
                      ____________________________________________________________
consensus TCTGATAAAGCTGGCTTTCTACAGTTTATACACATTTGTACAAATTCCATTCTCTCCGAT
 
. : . : . : . : . : . :
rJMSF028I24+ ATAACTAAATCTGGGCACGTTTTGCTGCAATATGGAGGGGCAAACAGAATCATTTTTAGC
rJMSF025A16+ ATAACTAAATCTGGGCACGTTTTGCTGCAATATGGAGGGGCAAACAGAATCATTTTTAGC
rJMSF022E23+ ANAACTAAATCTGGGCACGNTNTGCTGCAATANGGAGGGGCAAACAGAATCATTTTTAGC
rJMFF004G17+ ATAACTAAATCTGGGCACGTTTTGCTGCAATATGGAGGGGCAAACAGAATCATTTTTAGC
rJMFF010P18+ ATAACTAAATCTGGGCACGTTTTGCTGCAATATGGAGGGGCAAACAGAATCATTTTTAGC
                      ____________________________________________________________
consensus ATAACTAAATCTGGGCACGTTTTGCTGCAATATGGAGGGGCAAACAGAATCATTTTTAGC
 
. : . : . : . : . : . :
rJMSF028I24+ TGGAGCCTTTAACCACTTTTATTTACCATTTTGGCTCAAAGATTCGGGAGCTCGGTCCCC
rJMSF025A16+ TGGAGCCTTTAACCACTTTTATTTACCATTTTGGCTCAAAGATTCGGGAGCTCGGTCCCC
rJMSF022E23+ TGGAGCCTTTAACCA
rJMFF004G17+ TGGAGCCTTTAACCACTTTTATTTACCATTTTGGCTCAAAGATTCGGGAGCTCGGTCCCC
rJMFF010P18+ TGGAGCCTTTAACCACTTTTATTTACCATTTTGGCTCAAAGATTCGGGAGCTCGGTCCCC
                      ____________________________________________________________
consensus TGGAGCCTTTAACCACTTTTATTTACCATTTTGGCTCAAAGATTCGGGAGCTCGGTCCCC
 
. : . : . : . : . : . :
rJMSF028I24+ AACACATTCCATGTGGACCCATGTATCGTTTTTTTATGCCTGCAGAGAATACGCCATTAC
rJMSF025A16+ AACACATTCCATGTGGACCCATGTATCGTTTTTTTATGCCTGCAGAGAATACGCCATTAC
rJMFF004G17+ AACACATTCCATGTGGACCCATGTATCGTTTTTTTATGCCTGCAGAGAATACGCCATTAC
rJMFF010P18+ AACACATTCCATGTGGACCCATGTATCGTTTTTTTATGCCTGCAGAGAATACGCCATTAC
                      ____________________________________________________________
consensus AACACATTCCATGTGGACCCATGTATCGTTTTTTTATGCCTGCAGAGAATACGCCATTAC
 
. : . : . : . : . : . :
rJMSF028I24+ ATTACAGATTCTGGGTTTCCTGCAGGAATGACAGTTTTTACGAGTAAACTATGCGTATCA
rJMSF025A16+ ATTACAGATTCTGGGTTTCCTGCAGGAATGACAGTTTTTACGAGTAAACTATGCATATCA
rJMFF004G17+ ATTACAGATTCTGGGTTTCCTGCAGGAATGACAGTTTTTACGAGTAAACTATGCATATCA
rJMFF010P18+ ATTACAGATTCTGGGTTTCCTGCAGGAATGACAGTTTTTACGAGTAAACTATGCATATCA
                      ____________________________________________________________
consensus ATTACAGATTCTGGGTTTCCTGCAGGAATGACAGTTTTTACGAGTAAACTATGCATATCA
 
. : . : . : . : . : . :
rJMSF028I24+ TATATTTTCTGATCTAGTACAACAGTATTCACCGTCTTTTACCTTGTCCGTTTGTAGCAT
rJMSF025A16+ TATATTTTCTGATCTAGTACAACAGTATTCACCGTCTTTTACCTTGTCCGTTTGTAGCAT
rJMFF004G17+ TATATTTTCTGATCTAGTACAACAGTATTCACCGTCTTTTACCTTGTCCGTTTGTAGCAT
rJMFF010P18+ TATATTTTCTGATCTAGTACAACAGTATTCACCGTCTTTTACCTTGTCCGTTTGTAGCAT
                      ____________________________________________________________
consensus TATATTTTCTGATCTAGTACAACAGTATTCACCGTCTTTTACCTTGTCCGTTTGTAGCAT
 
. : . : . : . : . : . :
rJMSF028I24+ NCCCTGACTTTTGATGTCTCTAA
rJMSF025A16+ -CCCTGACTTTTGATGTCTCTAAACACAGTTT
rJMFF004G17+ -CCCTGACTTTTGATGTCTCTAAACACAGTTTGTTTATTACCCATTTGCATTT
rJMFF010P18+ -CCCTGACTTTTGATGTCTCTAAACACAGTTTGTTTATTACCCATTTGCATTTATATATT
                      ____________________________________________________________
consensus -CCCTGACTTTTGATGTCTCTAAACACAGTTTGTTTATTACCCATTTGCATTTATATATT