Previous Contig 008678:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010N18Sequence542000567 (9)gb:AY178911_15874084e-37Lycopersicon esculentum vacuolar H+-ATPase A2 subunit isoform mRNA, complete cds773008678 (6)gb:AY177247_15871505e-57Lycopersicon esculentum vacuolar H+-ATPase A1 subunit isoform mRNA, complete cds
JMFF017K12Sequence578000567 (9)gb:AY178911_15874083e-64Lycopersicon esculentum vacuolar H+-ATPase A2 subunit isoform mRNA, complete cds649008678 (6)gb:AY177247_15871503e-41Lycopersicon esculentum vacuolar H+-ATPase A1 subunit isoform mRNA, complete cds
JMFF018K21Sequence556000567 (9)gb:AY178911_15874084e-60Lycopersicon esculentum vacuolar H+-ATPase A2 subunit isoform mRNA, complete cds757008678 (6)gb:AY177247_15871503e-63Lycopersicon esculentum vacuolar H+-ATPase A1 subunit isoform mRNA, complete cds
JMFF040C17Sequence498000567 (9)gb:AY178911_15874082e-46Lycopersicon esculentum vacuolar H+-ATPase A2 subunit isoform mRNA, complete cds679008678 (6)gb:AY177247_15871505e-42Lycopersicon esculentum vacuolar H+-ATPase A1 subunit isoform mRNA, complete cds
JMSF027B02Sequence621000567 (9)gb:AY178911_15874082e-66Lycopersicon esculentum vacuolar H+-ATPase A2 subunit isoform mRNA, complete cds731008678 (6)gb:AY177247_15871502e-53Lycopersicon esculentum vacuolar H+-ATPase A1 subunit isoform mRNA, complete cds
JMSF050E13Sequence682000567 (9)gb:AY178911_15874082e-83Lycopersicon esculentum vacuolar H+-ATPase A2 subunit isoform mRNA, complete cds791008678 (6)gb:AY177247_15871508e-64Lycopersicon esculentum vacuolar H+-ATPase A1 subunit isoform mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF018K21+ AAGGATGCTTTAGCTGAAACCGATAAAA
rJMSF050E13+ GAAAGGATGCTTTAGCTGAAACCGATAAAA
                      ____________________________________________________________
consensus GAAAGGATGCTTTAGCTGAAACCGATAAAA
 
. : . : . : . : . : . :
rJMFF018K21+ TTACCCTTGAAACTGCCAAGCTGCTGAGGGAAGACTACCTTGCACAAAATGCTTTTACAC
rJMSF050E13+ TTACCCNTGAAACTGCCAAGCTGCTGAGGGAAGACTACCTTGCACAAAATGCTTTTACAC
rJMSF027B02+ GAAGACTACCTTGCACAAAATGCTTTTACAC
rJMFF010N18+ TTGAAACTGCCAAGCTGCTGAGGGAAGACTACCTTGCACAAAATGCTTTTACAC
                      ____________________________________________________________
consensus TTACCCTTGAAACTGCCAAGCTGCTGAGGGAAGACTACCTTGCACAAAATGCTTTTACAC
 
. : . : . : . : . : . :
rJMFF018K21+ CATATGATAAATTCTGCCCCTTCTACAAGTCTGTTTGGATGTTGCGCAACATTATACACT
rJMFF017K12+ TCTACAAGTCTGTTTGGATGTTGCGCAACATTATACACT
rJMSF050E13+ CATATGATAAATTCTGCCCCTTCTACAAGTCTGTTTGGATGTTGCGCAACATTATACACT
rJMSF027B02+ CATATGATAAATTCTGCCCCTTCTACAAGTCTGTTTGGATGTTGCGCAACATTATACACT
rJMFF040C17+ TACAAGTCTGTTTGGATGTTGCGCAACATTATACACT
rJMFF010N18+ CATATGATAAATTCTGCCCCTTCTACAAGTCTGTTTGGATGTTGCGCAACATTATACACT
                      ____________________________________________________________
consensus CATATGATAAATTCTGCCCCTTCTACAAGTCTGTTTGGATGTTGCGCAACATTATACACT
 
. : . : . : . : . : . :
rJMFF018K21+ TCTACAACTTGGCAAATCAGGCTGTCGAGCGAGGAGCTGGTATGGATGGTCAAAAGATCA
rJMFF017K12+ TCTACAACTTGGCAAATCAGGCTGTCGAGCGAGGAGCTGGTATGGATGGTCAAAAGATCA
rJMSF050E13+ TCTACAACTTGGCAAATCAGGCTGTCGAGCGAGGAGCTGGTATGGATGGTCAAAAGATCA
rJMSF027B02+ TCTACAACTTGGCAAATCAGGCTGTCGAGCGAGGAGCTGGTATGGATGGTCAAAAGATCA
rJMFF040C17+ TCTACAACTTGGCAAATCAGGCTGTCGAGCGAGGAGCTGGTATGGATGGTCAAAAGATCA
rJMFF010N18+ TCTACAACTTGGCAAATCAGGCTGTCGAGCGAGGAGCTGGTATGGATGGTCAAAAGATCA
                      ____________________________________________________________
consensus TCTACAACTTGGCAAATCAGGCTGTCGAGCGAGGAGCTGGTATGGATGGTCAAAAGATCA
 
. : . : . : . : . : . :
rJMFF018K21+ CTTATAGTTTGATTAAGCACCGCCTTGGAGATCTGTTNTACCGTTTGGTGTCTCAAAAAT
rJMFF017K12+ CTTATAGTTTGATTAAGCACCGCCTNGGAGATCTGTTNTACCGTTTGGTGTCTCAAAAAT
rJMSF050E13+ CTTATAGTTTGATTAAGCACCGCCTTGGAGATCTGTTCTACCGTTTGGTGTCTCAAAAAT
rJMSF027B02+ CTTATAGTTTGATTAAGCACCGCCTTGGAGATCTGTTCTACCGTTTGGTGTCTCAAAAAT
rJMFF040C17+ CTTATAGTTTGATTAAGCACCGCCTTGGAGATCTGTTCTACCGTTTGGTGTCTCAAAAAT
rJMFF010N18+ CTTATAGTTTGATTAAGCACCGCCTTGGAGATCTGTTCTACCGTTTGGTGTCTCAAAAAT
                      ____________________________________________________________
consensus CTTATAGTTTGATTAAGCACCGCCTTGGAGATCTGTTCTACCGTTTGGTGTCTCAAAAAT
 
. : . : . : . : . : . :
rJMFF018K21+ TTGAGGACCCTGCTGAAGGAGAAGATGTCTTGGTGGCCAGGTTCAAAAAGCTTCACGATG
rJMFF017K12+ TTGAGGACCCTGCTGAAGGAGAAGATGTCTTGGTGGCCAAGTTCAAAAAGCTTCACGATG
rJMSF050E13+ TTGAGGACCCTGCTGAAGGAGAAGATGTCTTGGTGGCCAAGTTCAAAAAGCTTCACGATG
rJMSF027B02+ TTGAGGACCCTGCTGAAGGAGAAGATGTCTTGGTGGCCAAGTTCAAAAAGCTTCACGATG
rJMFF040C17+ TTGAGGACCCTGCTGAAGGAGAAGATGTCTTGGTGGCCAAGTTCAAAAAGCTTCACGATG
rJMFF010N18+ TTGAGGACCCTGCTGAAGGAGAAGATGTCTTGGTGGCCAAGTTCAAAAAGCTTCACGATG
                      ____________________________________________________________
consensus TTGAGGACCCTGCTGAAGGAGAAGATGTCTTGGTGGCCAAGTTCAAAAAGCTTCACGATG
 
. : . : . : . : . : . :
rJMFF018K21+ ATTTGATTGCTGGCTTCCGTAACCTTGAAGATGAAACTCGATGAATGCCATGTGACACCC
rJMFF017K12+ ATTTGATTGCTGGCTTCCGTAACCTTGAAGATGAAACTCGATGAATGCCATGTGACACCC
rJMSF050E13+ ATTTGATTGCTGGCTTCCGTAACCTTGAAGATGAAACTCGATGAATGCCATGTGACACCC
rJMSF027B02+ ATTTGATTGCTGGCTTCCGTAACCTTGAAGGTGAAACTCGATGAATGCCATGTGACACCC
rJMFF040C17+ ATTTGATTGCTGGCTTCCGTAACCTTGAGGATGAAACTCGATGAATGCCATGTGACACCC
rJMFF010N18+ ATTTGATTGCTGGCTTCGGTAACCTTGAAGATGAAACTCGATGAATGCCATGTGACACCC
                      ____________________________________________________________
consensus ATTTGATTGCTGGCTTCCGTAACCTTGAAGATGAAACTCGATGAATGCCATGTGACACCC
 
. : . : . : . : . : . :
rJMFF018K21+ ACGTATTCGGATAATTCGGGTTGTCTATACATGAAGCAAAAAGTGAGTTTTTTTTCTTGT
rJMFF017K12+ ACGTATTCGGATAATTCGGGTTGTCTATACATGAAGCAAAAAGTGAGTTTTTTTTCTTGT
rJMSF050E13+ ACGTATTCGGATAATTCGGGTTGTCTATACATGAAGCAAAAAGTGAGTTTTTTTTCTTGT
rJMSF027B02+ ACGTATTCGGATAATTCGGGTTGTCTATACATGAAGCAAAAAGTGAGTTTTTTTTCTTGT
rJMFF040C17+ ACGTATTCGGATAATTCGGGTTGTCTATACATGAAGCAAAAAGTGAGTTTTTTTTCTTGT
rJMFF010N18+ ACGTATTCGGATAATTCGGGTTGTCTATACATGAAGCAAAAAGTGAGTTTTTTTTCTTGT
                      ____________________________________________________________
consensus ACGTATTCGGATAATTCGGGTTGTCTATACATGAAGCAAAAAGTGAGTTTTTTTTCTTGT
 
. : . : . : . : . : . :
rJMFF018K21+ ATTAGCATATTGCATCAATCAGGGATTTCGATGCATGCCTCTCTGGTCCACAATCCTGGT
rJMFF017K12+ ATTAGCATATTGCATCAATCAGGGATTTCGATGCATGCCTCTCTGGTCCACAATCCTGGT
rJMSF050E13+ ATTAGCATATTGCATCAATCAGGGATTTCGATGCATGCCTCTCTGGTCCACAATCCTGGT
rJMSF027B02+ ATTAGCATATTGCATCAATCAGGGATTTCGATGCATGCCTCTCTGGTCCACAATCCTGGT
rJMFF040C17+ ATTAGCATATTGCATCAATCAGGGATTTCGATGCATGCCTCTCTGGTCCACAATCCTGGT
rJMFF010N18+ ATTAGCATATTGCATCAATCAGGGATTTCGATGCATGCCTCTCTGGTCCACAATCCTGGT
                      ____________________________________________________________
consensus ATTAGCATATTGCATCAATCAGGGATTTCGATGCATGCCTCTCTGGTCCACAATCCTGGT
 
. : . : . : . : . : . :
rJMFF018K21+ AGAACAGGAGAATTAAGACACGGAAGAAGAAGAAGAAACAGTGCTTGTTTGGCAGTTCCA
rJMFF017K12+ AGAACAGGAGAATTAAGACACGGAAGAAGAAGAAGAAACAGTGCTTGTTTGGCAGTTCCA
rJMSF050E13+ AGAACAGGAGAATTAAGACACGGAAGAAGAAGAAGAAACAGTGCTTGTTTGGCAGTTCCA
rJMSF027B02+ AGAACAGGAGAATTAAGACACGGAAGAAGAAGAAGAAACAGTGCTTGTTTGGCAGTTCCA
rJMFF040C17+ AGAACAGGAGAATTAAGACACGGAAGAAGAAGAAGAAACAGTGCTTGTTTGGCAGTTCCA
rJMFF010N18+ AGAACAGGAGAATTAAGACACGGAAGAAGAAGAAGAAACAGTGCTTGTTTGGCAGTTCCA
                      ____________________________________________________________
consensus AGAACAGGAGAATTAAGACACGGAAGAAGAAGAAGAAACAGTGCTTGTTTGGCAGTTCCA
 
. : . : . : . : . : . :
rJMFF018K21+ CATTTTGTGTTAGCTTTTTCTGTATGTAGCTTGGTGAGTCCA-TTTTTTTGCCGTTAATT
rJMFF017K12+ CATTTTGTGTTAGCTTTTTCTGTATGTAGCTTGGTGAGTCCA-TTTTTTTGCCGTTAATT
rJMSF050E13+ CATTTTGTGTTAGCTTTTTCTGTATGTAGCTTGGTGAGTCCA-TTTTTTTGCCGTTAATT
rJMSF027B02+ CATTTTGTGTTAGCTTTTTCTGTATGTAGCTTGGTGAGTCCA-TTTTTTTGCCGTTAATT
rJMFF040C17+ CATTTTGTGTTAGCTTTTTCTGTATGTAGCTTGGTGAGTCCATTTTTTTTGCCGTTAATT
rJMFF010N18+ CATTTTGTGTTAGCTTTTTCTGTATGTAGCTTGGTGAGTCCA-TTTTTTTGCCGTTAATT
                      ____________________________________________________________
consensus CATTTTGTGTTAGCTTTTTCTGTATGTAGCTTGGTGAGTCCA-TTTTTTTGCCGTTAATT
 
. : . : . : . : . : . :
rJMFF018K21+ AAAAGAAATAAGAGGTGCCACCTAGGTATATTTATTTATTTATTGTATTTGCTGGTCTTC
rJMFF017K12+ AAAAGAAATAAGAGGTGCCACCTAGGTATATTTATTTATTTATTGTATTTGCTGGTCTTC
rJMSF050E13+ AAAAGAAATAAGAGGTGCCACCTAGGTATATTTATTTATTTATTGTATTTGCTGGTCTTC
rJMSF027B02+ AAAAGAAATAAGAGGTGCCACCTAGGTATATTTATTTATTTATTGTATTTGCTGGTCTTC
rJMFF040C17+ AAAAGAAATAAGAGGTGCCACCTAGGTATATTTATTTATTTATTGTATTTGCTGGTCTTC
rJMFF010N18+ AAAAGAAATAGGAGGTGCCACCTAGGTATATTTATTTATTTATTGTATTTGCTGGTCTTC
                      ____________________________________________________________
consensus AAAAGAAATAAGAGGTGCCACCTAGGTATATTTATTTATTTATTGTATTTGCTGGTCTTC
 
. : . : . : . : . : . :
rJMFF018K21+ ACTCTTCATCACCGGGTCTTAAAGATTTGAACTGTAATTGATATTTTCTTATCCCTGTCC
rJMFF017K12+ ACTCTTCATCACCGGGTCTTAAAGATTTGAACTGTAATTGATATTTTCTTATCCCTGTCC
rJMSF050E13+ ACTCTTCATCACCGGGTCTTAAAGATTTGAACTGTAATTGATATTTTCTTATCCCTGTCC
rJMSF027B02+ ACTCTTCATCACCGGGTCTTAAAGATTTGAACTGTAATTGATATTTTCTTATCCCTGTCC
rJMFF040C17+ ACTCTTCATCACCGGGTCTTAAAGATTTGAACTGTAATTGATATTTTCTTATCCCTGTCC
rJMFF010N18+ ACTCTTCATCACCGGGTCTTAAAGATTTGAACTGTAATTGATATTTTCTTATCCCTGTCC
                      ____________________________________________________________
consensus ACTCTTCATCACCGGGTCTTAAAGATTTGAACTGTAATTGATATTTTCTTATCCCTGTCC
 
. : . : . : . : . : . :
rJMFF018K21+ TAATAATTCG
rJMFF017K12+ TAATAATTCGT
rJMSF050E13+ TAATAATTCGTGTATTACAAC-TGAAATTCACTAC
rJMSF027B02+ TAATAATTCGTGTATTACAACTTGAAATTCACTAC
rJMFF040C17+ TAATAATTCGTGTATTACAACTTGAAATTCACTAC
rJMFF010N18+ TAATAATTCGTGTATTACAACTTGAAATTCACTACGGGGTTCCCTTTTGTTTATCAGATC
                      ____________________________________________________________
consensus TAATAATTCGTGTATTACAACTTGAAATTCACTACGGGGTTCCCTTTTGTTTATCAGATC