Previous Contig 008674:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010M15Sequence650008674 (4)695008674 (4)
JMFF010M16Sequence172008674 (4)
JMFN013O13Sequence613008674 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN013O13- CAGAACGGCGA
JMFF010M15- TCCTGACTACCAGGGGAAGAGGCGCAGAACGGCGA
rJMFF010M15+ TCCTGACTACCAGGGGAAGAGGCGCAGAACGGCGA
                      ____________________________________________________________
consensus TCCTGACTACCAGGGGAAGAGGCGCAGAACGGCGA
 
. : . : . : . : . : . :
JMFN013O13- TTAACCCGAGGCACCAGAAACGCGTTTCAACAAACTCAGGGAGATCTGATTGAGGCGTGA
JMFF010M15- TTAACCCGAGGCACCAGAAACGCGTTTCAACAAACTCAGGGAGATCTGATTGAGGCGTGA
rJMFF010M15+ TTAACCCGAGGCACCAGAAACGCGTTTCAACAAACTCAGGGAGATCTGATTGAGGCGTGA
                      ____________________________________________________________
consensus TTAACCCGAGGCACCAGAAACGCGTTTCAACAAACTCAGGGAGATCTGATTGAGGCGTGA
 
. : . : . : . : . : . :
JMFN013O13- GCGATAGAATCTCTGGTGATCGAAGCAGTTTTAGTGAGGAAGCTCGGAAAAGTTGTTGAG
rJMFF010M16+ CGAAGCAGTTTTAGTGAGGAAGCTCGGAAAAGTTGTTGAG
JMFF010M15- GCGATAGAATCTCTGGTGATCGAAGCAGTTTTAGTGAGGAAGCTCGGAAAAGTTGTTGAG
rJMFF010M15+ GCGATAGAATCTCTGGTGATCGAAGCAGTTTTAGTGAGGAAGCTCGGAAAAGTTGTTGAG
                      ____________________________________________________________
consensus GCGATAGAATCTCTGGTGATCGAAGCAGTTTTAGTGAGGAAGCTCGGAAAAGTTGTTGAG
 
. : . : . : . : . : . :
JMFN013O13- CCTGAGTAGTATAAAAGAGGTGCGTTTGAAGGGGGATGCATCATCGTTCTCACCGGAAAA
rJMFF010M16+ CCTGAGTAGTATAAAAGAGGTGCGTTTGAAGGGGGATGCATCATCGTTCTCNCCGGAAAA
JMFF010M15- CCTGAGTAGTATAAAAGAGGTGCGTTTGAAGGGGGATGCATCATCGTTCTCACCGGAAAA
rJMFF010M15+ CCTGAGTAGTATAAAAGAGGTGCGTTTGAAGGGGGATGCATCATCGTTCTCACCGGAAAA
                      ____________________________________________________________
consensus CCTGAGTAGTATAAAAGAGGTGCGTTTGAAGGGGGATGCATCATCGTTCTCACCGGAAAA
 
. : . : . : . : . : . :
JMFN013O13- TTACAAAAGAGCGGGAGTGGCTGTGCGATTTCCGTCGCAAGTCTGTTCTGTGCGTGCAAT
rJMFF010M16+ TTACAAAAGAGCGGGAGTGGCTGTGCGATTTCCGTCGCAAGTCTGTTCTGTGCGTGCAAT
JMFF010M15- TTACAAAAGAGCGGGAGTGGCTGTGCGATTTCCGTCGCAAGTCTGTTCTGTGCGTGCAAT
rJMFF010M15+ TTACAAAAGAGCGGGAGTGGCTGTGCGATTTCCGTCGCAAGTCTGTTCTGTGCGTGCAAT
                      ____________________________________________________________
consensus TTACAAAAGAGCGGGAGTGGCTGTGCGATTTCCGTCGCAAGTCTGTTCTGTGCGTGCAAT
 
. : . : . : . : . : . :
JMFN013O13- TTTTCCCCGGCGCAGCTGCGAGTCTTCGACGGAAAATCTGTTATTGGCGGTGGTTGGATT
rJMFF010M16+ TTTTCCCCGGCG
JMFF010M15- TTTTCCCCGGCGCAGCTGCGAGTCTTCGACGGAAAATCTGTTATTGGCGGTGGTTGGATT
rJMFF010M15+ TTTTCCCCGGCGCAGCTGCGAGTCTTCGACGGAAAATCTGTTATTGGCGGTGGTTGGATT
                      ____________________________________________________________
consensus TTTTCCCCGGCGCAGCTGCGAGTCTTCGACGGAAAATCTGTTATTGGCGGTGGTTGGATT
 
. : . : . : . : . : . :
JMFN013O13- AATTTGGCAAAAAATCCTTCTCGGCAGTTCTGGGATTTAATTTCTAGCAGCGGCGACTTC
JMFF010M15- AATTTGGCAAAAAATCCTTCTCGGCAGTTCTGGGATTTAATTTCTAGCAGCGGCGACTTC
rJMFF010M15+ AATTTGGCAAAAAATCCTTCTCGGCAGTTCTGGGATTTAATTTCTAGCAGCGGCGACTTC
                      ____________________________________________________________
consensus AATTTGGCAAAAAATCCTTCTCGGCAGTTCTGGGATTTAATTTCTAGCAGCGGCGACTTC
 
. : . : . : . : . : . :
JMFN013O13- GACTT-CCAATAGGCAGCAACAATTCGTCTGCAGTGGCTTGGCAATTTCTGGTTCTTTCT
JMFF010M15- GACTT-CCAATAGGCAGCAACAATTCGTCTGCAGTGGCTTGGCAATTTCTGGTTCTTTCT
rJMFF010M15+ GACTTCCCAATAGGCAGCAACAATTCGTCTGCAGTGGCTTGGCAATTTCTGGTTCTTTCT
                      ____________________________________________________________
consensus GACTT-CCAATAGGCAGCAACAATTCGTCTGCAGTGGCTTGGCAATTTCTGGTTCTTTCT
 
. : . : . : . : . : . :
JMFN013O13- TTAATTTTTCCTTAATTTGGGCCTGTTGGCTTCTTCGTAATTGTTAACAACAATCAATTT
JMFF010M15- TTAATTTTTCCTTAATTTGGGCCTGTTGGCTTCTTCGTAATTGTTAACAACAATCAATTT
rJMFF010M15+ TTAATTTTTCCTTAATTTGGGCCTGTTGGCTTCTTCGTAATTGTTAACAACAATCAATTT
                      ____________________________________________________________
consensus TTAATTTTTCCTTAATTTGGGCCTGTTGGCTTCTTCGTAATTGTTAACAACAATCAATTT
 
. : . : . : . : . : . :
JMFN013O13- AGTGTGGGTTTGTAACCCACTGTCCTTTTAATTTCAATTCTGCTGAATTGTTTGTGCTGC
JMFF010M15- AGTGTGGGTTTGTAACCCACTGTCCTTTTAATTTCAATTCTGCTGAATTGTTTGTGCTGC
rJMFF010M15+ AGTGTGGGTTTGTAACCCACTGTCCTTTTAATTTCAATTCTGCTGAATTGTTTGTGCTGC
                      ____________________________________________________________
consensus AGTGTGGGTTTGTAACCCACTGTCCTTTTAATTTCAATTCTGCTGAATTGTTTGTGCTGC
 
. : . : . : . : . : . :
JMFN013O13- TATGTAATGCTTAATGATGTTGCTAATTACCATGCTTAATGCTTAATGCTTAAGTATGTT
JMFF010M15- TATGTAATGCTTAATGATGTTGCTAATTACCATGCTTAATGCTTAATGCTTAAGTATGTT
rJMFF010M15+ TATGTAATGCTTAATGATGTTGCTAATTACCATGCTTAATGCTTAATGCTTAAGTATGTT
                      ____________________________________________________________
consensus TATGTAATGCTTAATGATGTTGCTAATTACCATGCTTAATGCTTAATGCTTAAGTATGTT
 
. : . : . : . : . : . :
JMFN013O13- GCT
JMFF010M15- GCTAATTGTGATGCCT
rJMFF010M15+ GCTAATTGTGATGCCTACTTGGTGGCGTTGATTGTTTTTGTTGCCAAGTCCGGAAAAGAT
                      ____________________________________________________________
consensus GCTAATTGTGATGCCTACTTGGTGGCGTTGATTGTTTTTGTTGCCAAGTCCGGAAAAGAT