Previous Contig 008663:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010L15Sequence658007694 (6)gb:AE005173_8932732e-63Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC024260_153720008663 (5)pir|F96577|F965771e-62hypothetical protein F22G10.3 [imported] - Arabidopsis thaliana>gb:AE005173_8932
JMFF010O24Sequence526007694 (6)gb:AB022220_15151448e-39Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLN21.>gb:AY518292_161766008663 (5)pir|F96577|F965772e-69hypothetical protein F22G10.3 [imported] - Arabidopsis thaliana>gb:AE005173_8932
JMFF024J17Sequence529007694 (6)gb:AB022220_15151442e-48Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLN21.>gb:AY518292_161720008663 (5)pir|F96577|F965773e-62hypothetical protein F22G10.3 [imported] - Arabidopsis thaliana>gb:AE005173_8932
JMSF043H19Sequence790007694 (6)gb:AB022220_15151442e-76Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLN21.>gb:AY518292_161670008663 (5)pir|F96577|F965772e-59hypothetical protein F22G10.3 [imported] - Arabidopsis thaliana>gb:AE005173_8932
JMSF045O23Sequence754007694 (6)gb:AB022220_15151441e-65Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLN21.>gb:AY518292_161674008663 (5)pir|F96577|F965775e-66hypothetical protein F22G10.3 [imported] - Arabidopsis thaliana>gb:AE005173_8932

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF045O23+ CGGAGTTCAACCCCTCACCTATCGGACT
rJMFF010O24+ GCTAACGTTTTACTTGATTCGGAGTTCAA-CCCTCACCTATCGGACT
rJMFF024J17+ T
rJMFF010L15+ T
                      ____________________________________________________________
consensus GCTAACGTTTTACTTGATTCGGAGTTCAACCCCTCACCTATCGGACT
 
. : . : . : . : . : . :
rJMSF045O23+ CTGGGTTAGCTAGCCTTATCCCAGACGAAGATCAGGCTCTAAACCAGAATTCAGCGTCTG
rJMFF010O24+ CTGGGTTAGCTAGCCTTATCCCAGACGAAGATCAGGCTCTAAACCAGAATTCAGCGTCTG
rJMFF024J17+ CTGGGTTAGCTAGCCTTATCCCAGACGAAGATCAGGCTCTAAACCAGAATTCAGCGTCTG
rJMSF043H19+ AAGATCAGGCTCTAAACCAGAATTCAGCGTCTG
rJMFF010L15+ CTGGGTTAGCTAGCCTTATCCCAGACGAAGATCAGGCTCTAAACCAGAATTCAGCGTCTG
                      ____________________________________________________________
consensus CTGGGTTAGCTAGCCTTATCCCAGACGAAGATCAGGCTCTAAACCAGAATTCAGCGTCTG
 
. : . : . : . : . : . :
rJMSF045O23+ GATATGGTGCGCCTGAGGTGGCCATGTCTGGTCAGTATACAATAAAGAGCGATGTGTACA
rJMFF010O24+ GATAAGGTGCGCCTGAGGTGGCCATGTCTGGTCAGTATACAATAAAGAGCGATGTGTACA
rJMFF024J17+ GATATGGTGCGCCTGAGGTGGCCATGTCTGGTCAGTATACAATAAAGAGCGATGTGTACA
rJMSF043H19+ GATATGGTGCGCCTGAGGTGGCCATGTCTGGTCAGTATACAATAAAGAGCGATGTGTACA
rJMFF010L15+ GATATGGTGCGCCTGAGGTGGCCATGTCTGGTCAGTATACAATAAAGAGCGATGTGTACA
                      ____________________________________________________________
consensus GATATGGTGCGCCTGAGGTGGCCATGTCTGGTCAGTATACAATAAAGAGCGATGTGTACA
 
. : . : . : . : . : . :
rJMSF045O23+ GTTTTGGCGTTGCCATGTTGGAACTTCTTACTGGAAGAACACCATTTGACAGTTCAAGGC
rJMFF010O24+ GTTTTGGCGTTGCCATGTTGGAACTTCTTACTGGAAGAACACCATTTGACAGTTCAAGGC
rJMFF024J17+ GTTTTGGCGTTGCCATGTTGGAACTTCTTACTGGAAGAACACCATTTGACAGTTCAAGGC
rJMSF043H19+ GTTTTGGCGTTGCCATGTTGGAACTTCTTACTGGAAGAACACCATTTGACAGTTCAAGGC
rJMFF010L15+ GTTTTGGCGTTGCCATGTTGGAACTTCTTACTGGAAGAACACCATTTGACAGTTCAAGGC
                      ____________________________________________________________
consensus GTTTTGGCGTTGCCATGTTGGAACTTCTTACTGGAAGAACACCATTTGACAGTTCAAGGC
 
. : . : . : . : . : . :
rJMSF045O23+ CAAGACCCGAGCAATCCTTAGTTCGATGGGCTACACCTCAGCTCCACGACATTGACGCCT
rJMFF010O24+ CAAGACCCGAGCAATCCTTAGTTCGATGGGCTACACCTCAGCTCCACGACATTGACGCCT
rJMFF024J17+ CAAGACCCGAGCAATCCTTAGTTCGATGGGCTACACCTCAGCTCCACGACATTGACGCCT
rJMSF043H19+ CAAGACCCGAGCAATCCTTAGTTCGATGGGCTACACCTCAGCTCCACGACATTGACGCCT
rJMFF010L15+ CAAGACCCGAGCAATCCTTAGTTCGATGGGCTACACCTCAGCTCCACGACATTGACGCCT
                      ____________________________________________________________
consensus CAAGACCCGAGCAATCCTTAGTTCGATGGGCTACACCTCAGCTCCACGACATTGACGCCT
 
. : . : . : . : . : . :
rJMSF045O23+ TATCTAAGATGGTTGATCCAGCACTGAAAGGGCTCTATCCAGTTAAATCTCTCTCCCGCT
rJMFF010O24+ TATCTAAGATGGTTGATCCAGCACTGAAAGGGCTCTATCCAGTTAAATCTCTCTCCCGCT
rJMFF024J17+ TATCTAAGATGGTTGATCCAGCACTGAGAGGGCTCTATCCAGTTAAATCTCTCTCCCGCT
rJMSF043H19+ TATCTAAGATGGTTGATCCAGCACTGAAAGGGCTCTATCCAGTTAAATCTCTCTCCCGCT
rJMFF010L15+ TATCTAAGATGGTTGATCCAGCACTGAAAGGGCTCTATCCAGTTAAATCTCTCTCCCGCT
                      ____________________________________________________________
consensus TATCTAAGATGGTTGATCCAGCACTGAAAGGGCTCTATCCAGTTAAATCTCTCTCCCGCT
 
. : . : . : . : . : . :
rJMSF045O23+ TTGCTGATGTCATTGCACTATGTGTCCAGCCGGAGCCTGAGTTCCGACCACCTATGTCGG
rJMFF010O24+ TTGCTGATGTCATTGCACTATGTGTCCAGCCGGAGCCTGAGTTCCGACCACCTATGTCGG
rJMFF024J17+ TTGCTGATGTCATTGCACTATGTGTCCAGCCGGAGCCTGAGTTCCGACCACCTATGTCGG
rJMSF043H19+ TTGCTGATGTCATTGCACTATGTGTCCAGCCGGAGCCTGAGTTCCGACCACCTATGTCGG
rJMFF010L15+ TTGCTGATGTCATTGCACTATGTGTCCAGCCGGAGCCTGAGTTCCGACCACCTATGTCGG
                      ____________________________________________________________
consensus TTGCTGATGTCATTGCACTATGTGTCCAGCCGGAGCCTGAGTTCCGACCACCTATGTCGG
 
. : . : . : . : . : . :
rJMSF045O23+ AAGTTGTTGAGGCGTTGGTCCGGCTGGTGCAACGGGCCAACATGAGCAGGAGGACATTCG
rJMFF010O24+ AAGTTGTTGAGGCGTTGGTCCGGCTGGTGCAACGGGCCAACATGAGCAGGAGGACATTCG
rJMFF024J17+ AAGTTGTTGAGGCGTTGGTCCGGCTGGTGCAACGGGCCAACATGAGCAGGAGGACATTCG
rJMSF043H19+ AAGTTGTTGAGGCGTTGGTCCGGCTGGTGCAACGGGCCAACATGAGCAGGAGGACATTCG
rJMFF010L15+ AAGTTGTTGAGGCGTTGGTCCGGCTGGTGCAACGGGCCAACATGAGCAGGAGGACATTCG
                      ____________________________________________________________
consensus AAGTTGTTGAGGCGTTGGTCCGGCTGGTGCAACGGGCCAACATGAGCAGGAGGACATTCG
 
. : . : . : . : . : . :
rJMSF045O23+ GCGCTGATTCAAGGACCAGGTCTGGTAGCGCAGATTCTCAGGAATACGAGCTTTAGATTC
rJMFF010O24+ GCGCTGATTCAAGGACCAGGTCTGGTAGCGCAGATTCTCAGGAATACGAGCTTTAGATTC
rJMFF024J17+ GCGCTGATTCAAGGACCAGGTCTGGTAGCGCAGATTCTCAGGAATACGAGCTTTAGATTC
rJMSF043H19+ GCGCTGATTCAAGGACCAGGTCTGGTAGCGCAGATTCTCAGGAATACGAGCTTTAGATTC
rJMFF010L15+ GCGCTGATTCAAGGACCAGGTCTGGTAGCGCAGATTCTCAGGAATACGAGCTTTAGATTC
                      ____________________________________________________________
consensus GCGCTGATTCAAGGACCAGGTCTGGTAGCGCAGATTCTCAGGAATACGAGCTTTAGATTC
 
. : . : . : . : . : . :
rJMSF045O23+ CTCGGACGCCATGTTTTGCTGCTCCTAATCCTGATGTTCGTTGTATCATAACGGTAGCGG
rJMFF010O24+ CTCGGACGCCATGTTTTGCTGCTCCTAATCCTGATGTTCGTTGTATCATAACGGTAGCGG
rJMFF024J17+ CTCGGACGCCATGTTTTGCTGCTCCTAATCCTGATGTTCGTTGTATCATAACGGTAGCGG
rJMSF043H19+ CTCGGACGCCATGTTTTGCTGCTCCTAATCCTGATGTTCGTTGTATCATAACGGTAGCGG
rJMFF010L15+ CTCGGACGCCATGTTTTGCTGCTCCTAATCCTGATGTTCGTTGTATCATAACGGTAGCGG
                      ____________________________________________________________
consensus CTCGGACGCCATGTTTTGCTGCTCCTAATCCTGATGTTCGTTGTATCATAACGGTAGCGG
 
. : . : . : . : . : . :
rJMSF045O23+ ATTCTGTAACATTGTTAATAGCGTGATCCGTTTCGTTTGCATTTGCTGCCATTAGATTAG
rJMFF010O24+ ATTCTGTAACATTGTTAATAGCGTGATCCGTTTCGTTTGCATTTGCTGCCATTAGATTAG
rJMFF024J17+ ATTCTGTAACATTGTTAATAGCGTGATCCGTTTCGTTTGCATTTGCTGCCATTAGATTAG
rJMSF043H19+ ATTCTGTAACATTGTTAATAGCGTGATCCGTTTCGTTTGCATTTGCTGCCATTAGATTAG
rJMFF010L15+ ATTCTGTAACATTGTTAATAGCGTGATCCGTTTCGTTTGCATTTGCTGCCATTAGATTAG
                      ____________________________________________________________
consensus ATTCTGTAACATTGTTAATAGCGTGATCCGTTTCGTTTGCATTTGCTGCCATTAGATTAG
 
. : . : . : . : . : . :
rJMSF045O23+ CTTCTTCTTCTTCTTCACCTTCTGCAGAACTGGACTCCTGGATTCT
rJMFF010O24+ CTTCTTCTTCTTCTTCACCTTCTGCAGAACTGGACTCCTGGATTCTTGTTTTTGTAATAT
rJMFF024J17+ CTTCTTCTTCTTCTTCACCTTCTGCAGAACTGGACTCCTGGATTCTTGTTTTTGTAATAT
rJMSF043H19+ CTTCTTCTTCTTCTTCACCTTCTGCAGAACTGGACTCCTGGATTCTTGTTTTTGTAATAT
rJMFF010L15+ CTTCTTCTTCTTCTTCACCTTCTGCAGAACTGGACTCCTGGATTCTTGTTTTTGTAATAT
                      ____________________________________________________________
consensus CTTCTTCTTCTTCTTCACCTTCTGCAGAACTGGACTCCTGGATTCTTGTTTTTGTAATAT
 
. : . : . : . : . : . :
rJMFF010O24+ GGGAGTCTATTGAGAAGAGTTGTGTACTATCTCACTCTGGATTTTTCCTCCTATACAACA
rJMFF024J17+ GGGAGTCTATTGAGAAGAGTTGTGTACTATCTCACTCTGGA-TTTTCCTCCTATACAACA
rJMSF043H19+ GGGAGTCTATTGAGAAGAGTTGTGTACTATCTCACTC
rJMFF010L15+ GGGAGTCTATTGAGAAGAGTTGTGTACTATCTCACTCTGGA-TTTTCCTCCTATACAACA
                      ____________________________________________________________
consensus GGGAGTCTATTGAGAAGAGTTGTGTACTATCTCACTCTGGA-TTTTCCTCCTATACAACA