Previous Contig 008661:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010K06Sequence518008661 (4)gb:AB047519_15206153e-19Prunus persica PpExp3 mRNA for expansin, complete cds.757008661 (4)gb:AF512542_18072904e-59Gossypium hirsutum alpha-expansin precursor (Exp4) gene, complete cds.
JMFF011M12Sequence539008661 (4)gb:AB047519_15206153e-19Prunus persica PpExp3 mRNA for expansin, complete cds.699008661 (4)gb:AB093033_15251371e-52Pyrus communis PcExp6 mRNA for expansin, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF010K06- GAATAATAATAATAATAAAGAAAAATAATAAAAACAACGTTTCTTTG
JMFF011M12- ATATTCAGAATAATAATAATAATAAAGAAAAATAATAAAAACAACGTTTCTTTG
                      ____________________________________________________________
consensus ATATTCAGAATAATAATAATAATAAAGAAAAATAATAAAAACAACGTTTCTTTG
 
. : . : . : . : . : . :
JMFF010K06- AGATCATAAGCAGATTCCCCTTTGGATTAATCTTTGTTTATGATCTCAAAAACAGTTTTA
JMFF011M12- AGATCATAAGCAGATTCCCCTTTGGATTAATCTTTGTTTATGATCTCAAAAACAGTTTTA
                      ____________________________________________________________
consensus AGATCATAAGCAGATTCCCCTTTGGATTAATCTTTGTTTATGATCTCAAAAACAGTTTTA
 
. : . : . : . : . : . :
JMFF010K06- GCTTAGCTTGATCGCCATGGCAGCAGAAATGCGATTGTCATTGTTGATTGTGTTGGTTGT
JMFF011M12- GCTTAGCTTGATCGCCATGGCAGCAGAAATGCGATTGTCATTGTTGATTGTGTTGGTTGT
                      ____________________________________________________________
consensus GCTTAGCTTGATCGCCATGGCAGCAGAAATGCGATTGTCATTGTTGATTGTGTTGGTTGT
 
. : . : . : . : . : . :
JMFF010K06- AGCGTTGCCCTGCGTATTTGCCCATAAGAGTGAATGGAAGGAAGCTCATGCCACCTATTA
JMFF011M12- AGCGTTGCCCTGCGTATTTGCCCATAAGAGTGAATGGAAGGAAGCTCATGCCACCTATTA
rJMFF010K06+ CCATAAGAGTGAATGGAAGGAAGCTCATGCCACCTATTA
                      ____________________________________________________________
consensus AGCGTTGCCCTGCGTATTTGCCCATAAGAGTGAATGGAAGGAAGCTCATGCCACCTATTA
 
. : . : . : . : . : . :
JMFF010K06- TGGCGCCCCTGAGGGCACCATCGGCGGAGCTTGTGGCTTCGAAGAATACAAACAAATCTA
JMFF011M12- TGGCGCCCCTGAGGGCACCATCGGCGGAGCTTGTGGCTTCGAAGAATACAAACAAATCTA
rJMFF011M12+ GAAGAATACAAACAAATCTA
rJMFF010K06+ TGGCGCCCNTGAGGGCACCATCGGCGGAGCTTGTGGCTTCGAAGAATACAAACAAATCTA
                      ____________________________________________________________
consensus TGGCGCCCCTGAGGGCACCATCGGCGGAGCTTGTGGCTTCGAAGAATACAAACAAATCTA
 
. : . : . : . : . : . :
JMFF010K06- TTCCCCATACACCGCAGCTCTGAGCCCAGCATTATACAACGAAGCAGAAAGCTGCGGCGC
JMFF011M12- TTCCCCATACACCGCAGCTCTGAGCCCAGCATTATACAACGAAGCAGAAAGCTGCGGCGC
rJMFF011M12+ TTCCCCATACACCGCAGCTCTGAGCCCAGCATTATACAACGAAGCAGAAAGCTGCGGCGC
rJMFF010K06+ TTCCCCATACACCGCAGCTCTGAGCCCAGCATTATACAACGAAGCAGAAAGCTGCGGCGC
                      ____________________________________________________________
consensus TTCCCCATACACCGCAGCTCTGAGCCCAGCATTATACAACGAAGCAGAAAGCTGCGGCGC
 
. : . : . : . : . : . :
JMFF010K06- CTGCTTCGAAATAAAATGCGTAGAATCCGAGTTTTGCAAGAAAGGCCACAAAACCCGTGG
JMFF011M12- CTGCTTCGAAATAAAATGCGTAGAATCCGAGTTTTGCAAGAAAGGCCACAAACCCCGTGG
rJMFF011M12+ CTGCTTCGAAATAAAATGCGTAGAATCCGAGTTTTGCAAGAAAGGCCACAAA-CCCGTGG
rJMFF010K06+ CTGCTTCGAAATAAAATGCGTAGAATCCGAGTTTTGCAAGAAAGGCCACAAA-CCCGTGG
                      ____________________________________________________________
consensus CTGCTTCGAAATAAAATGCGTAGAATCCGAGTTTTGCAAGAAAGGCCACAAA-CCCGTGG
 
. : . : . : . : . : . :
JMFF010K06- AGGTCACCGTCACGGATTCGTGCCCCGCGAGCGACGCCCGCTGCAGCCCGCCGCACGTAC
JMFF011M12- AGGTCACCGTCACGGATTCGTGCCCCGCGAGCGACGCCCGCTGCAGCCCGCCGCACGTAC
rJMFF011M12+ AGGTCACCGTCACGGATTCGTGCCCCGCGAGCGACGCCCGCTGCAGCCCGCCGCACGTAC
rJMFF010K06+ AGGTCACCGTCACGGATTCGTGCCCCGCGAGCGACGCCCGCTGCAGCCCGCCGCACGTAC
                      ____________________________________________________________
consensus AGGTCACCGTCACGGATTCGTGCCCCGCGAGCGACGCCCGCTGCAGCCCGCCGCACGTAC
 
. : . : . : . : . : . :
JMFF010K06- ATTTCGACTTGTCCCAGCCCGCGTTTCACGAGATCGCGGAGCACGA
JMFF011M12- ATTTCGACTTGTCCCAGCCCGCGTTTCACGAGATCGCGGAGCACGAAAGGCGGCGTGGTT
rJMFF011M12+ ATTTCGACTTGTCCCAGCCCGCGTTTCACGAGATCGCGGAGCACG-AAGGCGGCGTGGTT
rJMFF010K06+ ATTTCGACTTGTCCCAGCCCGCGTTTCACGAGATCGCGGAGCACG-AAGGCGGCGTGGTT
                      ____________________________________________________________
consensus ATTTCGACTTGTCCCAGCCCGCGTTTCACGAGATCGCGGAGCACGAAAGGCGGCGTGGTT
 
. : . : . : . : . : . :
JMFF011M12- CCGGT
rJMFF011M12+ CCGGTGAAGTACCGTAAGGTTCAGTGCAAGAGAAAGGGCGGGGTGAAGTTTACGATCACG
rJMFF010K06+ CCGGTGAAGTACCGTAAGGTTCAGTGCAAGAGAAAGGGCGGGGTGAAGTTTACGATCACG
                      ____________________________________________________________
consensus CCGGTGAAGTACCGTAAGGTTCAGTGCAAGAGAAAGGGCGGGGTGAAGTTTACGATCACG
 
. : . : . : . : . : . :
rJMFF011M12+ GGGAACCCTAATTTTAACTTGGTGACCGTGACGAATGTTGCCGGGGGCGGAGACCTTGAG
rJMFF010K06+ GGGAACCCTAATTTTAACTTGGTGACCGTGACGAATGTTGCCGGGGGCGGAGACCTTGAG
                      ____________________________________________________________
consensus GGGAACCCTAATTTTAACTTGGTGACCGTGACGAATGTTGCCGGGGGCGGAGACCTTGAG
 
. : . : . : . : . : . :
rJMFF011M12+ AAGGTGGAGGTGAAAGCTGATGGGGTGAAAGAATGGATAGAGATGAAACGCAACTGGGGT
rJMFF010K06+ AAGGTGGAGGTGAAAGCTGATGGGGTGAAAGAATGGATAGAGATGAAACGCAACTGGGGT
                      ____________________________________________________________
consensus AAGGTGGAGGTGAAAGCTGATGGGGTGAAAGAATGGATAGAGATGAAACGCAACTGGGGT
 
. : . : . : . : . : . :
rJMFF011M12+ GAGAAATGGGAGACCAATATAGATTTGTCTGGGAAATCTCTGACTTTTAGGATCACTACA
rJMFF010K06+ GAGAAATGGGAGACCAATATAGATTTGTCTGGGAAATCTNTGACTTTTAGGATCANTACA
                      ____________________________________________________________
consensus GAGAAATGGGAGACCAATATAGATTTGTCTGGGAAATCTCTGACTTTTAGGATCACTACA
 
. : . : . : . : . : . :
rJMFF011M12+ TGCGAAGGGCAAGTAGCTACTTCCAAGCATGTCGCCCCTGAGTCGTGGCAGTACGGCCAG
rJMFF010K06+ TGCGAAGGGCAAGTAGCTACTTCCAAGCATGTCGCCCCTGAGTCGTGGCAGTACGGCCAG
                      ____________________________________________________________
consensus TGCGAAGGGCAAGTAGCTACTTCCAAGCATGTCGCCCCTGAGTCGTGGCAGTACGGCCAG
 
. : . : . : . : . : . :
rJMFF011M12+ ACATTCGAAGGC
rJMFF010K06+ ACATTCGAAGGCAAAAACGTTTGATTCAACTCAACACAACACAATCTTTTGGTTTTTGTT
                      ____________________________________________________________
consensus ACATTCGAAGGCAAAAACGTTTGATTCAACTCAACACAACACAATCTTTTGGTTTTTGTT
 
. : . : . : . : . : . :
rJMFF010K06+ TTGCACATGCGCTACCTTAGTTGTAAATTGTAAATGCCGTCGGGCAGTGTTGAAGTAATG
                      ____________________________________________________________
consensus TTGCACATGCGCTACCTTAGTTGTAAATTGTAAATGCCGTCGGGCAGTGTTGAAGTAATG