Previous Contig 008655:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010I23Sequence554008655 (8)gb:AX046714_14580103e-24Sequence 1 from Patent WO0068393.771008655 (8)gb:AY826350_16290489e-83Vitis vinifera homogentisate geranylgeranyl transferase (HGGT) mRNA, complete cd
JMSF015K23Sequence338008655 (8)761008655 (8)gb:AY826350_16290482e-89Vitis vinifera homogentisate geranylgeranyl transferase (HGGT) mRNA, complete cd
JMSF021A12Sequence661008655 (8)gb:AX046714_14580109e-41Sequence 1 from Patent WO0068393.808008655 (8)gb:AY826350_16290488e-94Vitis vinifera homogentisate geranylgeranyl transferase (HGGT) mRNA, complete cd
JMSF021M02Sequence695008655 (8)gb:AX046714_14580102e-46Sequence 1 from Patent WO0068393.722008655 (8)gb:AY826350_16290482e-82Vitis vinifera homogentisate geranylgeranyl transferase (HGGT) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF010I23- GTTACTTATTACGTGTGTGAAGTGAAGT
JMSF021A12- GGTTCTCCGTTACTTATTACGTGTGTGAAGTGAAGT
JMSF021M02- GGTTCTCCGTTACTTATTACGTGTGTGAAGTGAAGT
                      ____________________________________________________________
consensus GGTTCTCCGTTACTTATTACGTGTGTGAAGTGAAGT
 
. : . : . : . : . : . :
JMSF015K23- GAAGGCAAAAATGGAGTCTCTGCTAATTGTGAAAACTTCATCTTCTCTT
JMFF010I23- AGTGAGAGAGAGAAGGCAAAAATGGAGTCTCTGCTAATTGTGAAAACTTCATCTTCTCTT
JMSF021A12- AGTGAGAGAGAGAAGGCAAAAATGGAGTCTCTGCTAATTGTGAAAACTTCATCTTCTCTT
JMSF021M02- AGTGAGAGAGAGAAGGCAAAAATGGAGTCTCTGCTAATTGTGAAAACTTCATCTTCTCTT
                      ____________________________________________________________
consensus AGTGAGAGAGAGAAGGCAAAAATGGAGTCTCTGCTAATTGTGAAAACTTCATCTTCTCTT
 
. : . : . : . : . : . :
JMSF015K23- TCGTTTCCGCTTAAATCTCACTTGTCGTCTTCATATTCACATCAAACAACACAAGTTTCA
JMFF010I23- TCGTTTCCGCTTAAATCTCACTTGTCGTCTTCATATTCACATCAAACAACACAAGTTTCA
JMSF021A12- TCGTTTCCGCTTAAATCTCACTTGTCGTCTTCATATTCACATCAAACAACACAAGTTTCA
JMSF021M02- TCGTTTCCGCTTAAATCTCACTTGTCGTCTTCATATTCACATCAAACAACACAAGTTTCA
                      ____________________________________________________________
consensus TCGTTTCCGCTTAAATCTCACTTGTCGTCTTCATATTCACATCAAACAACACAAGTTTCA
 
. : . : . : . : . : . :
JMSF015K23- AAGTGCAAAGCATTGAATGGCGGAGAAAAGCCCTGGCCGTTGCCCATGCGATTGCAGAGA
JMFF010I23- AAGTGCAAAGCATTGAATGGCGGAGAAAAGCCCTGGCCGTTGCCCATGCGATTGCAGAGA
JMSF021A12- AAGTGCAAAGCATTGAATGGCGGAGAAAAGCCCTGGCCGTTGCCCATGCGATTGCAGAGA
JMSF021M02- AAGTGCAAAGCATTGAATGGCGGAGAAAAGCCCTGGCCGTTGCCCATGCGATTGCAGAGA
                      ____________________________________________________________
consensus AAGTGCAAAGCATTGAATGGCGGAGAAAAGCCCTGGCCGTTGCCCATGCGATTGCAGAGA
 
. : . : . : . : . : . :
JMSF015K23- CCATTAGCGACACTAGAGCATGTTGGAAGCAGTGATGGAAGTATTATTAACTTAAGACAT
JMFF010I23- CCATTAGCGACACTAGAGCATGTTGGAAGCAGTGATGGAAGTATTATTAACTTAAGACAT
JMSF021A12- CCATTAGCGACACTGGAGCATGTTGGAAGCAGTGATGGAAGTATTATTAACTTAAGACAT
JMSF021M02- CCATTAGCGACACTGGAGCATGTTGGAAGCAGTGATGGAAGTATTATTAACTTAAGACAT
                      ____________________________________________________________
consensus CCATTAGCGACACTGGAGCATGTTGGAAGCAGTGATGGAAGTATTATTAACTTAAGACAT
 
. : . : . : . : . : . :
JMSF015K23- AGAGAAGGGTTTTCGGTGAATGCAGCAGCTTCAGATCATCCTCTTGAATCTGAGCCATCC
JMFF010I23- AGAGAAGGGTTTTCGGTGAATGCAGCAGCTTCAGATCATCCTCTTGAATCTGAGCCATCC
JMSF021A12- AGAGAAGGGTTTTCGGTGAATGCAGCAGCTTCAGATCATCCTCTTGAATCTGAGCCATCC
JMSF021M02- AGAGAAGGGTTTTCGGTGAATGCAGCAGCTTCAGATCATCCTCTTGAATCTGAGCCATCC
                      ____________________________________________________________
consensus AGAGAAGGGTTTTCGGTGAATGCAGCAGCTTCAGATCATCCTCTTGAATCTGAGCCATCC
 
. : . : . : . : . : . :
JMSF015K23- AACAGCCCTTCGAAGTCAGTTCAGGGGGTTTTGGATGCTTTCTACA
JMFF010I23- AACAGCCCTTCGAAGTCAGTTCAGGGGGTTTTGGATGCTTTCTACAGATTTTCGCGGCCT
JMSF021A12- AACAGCCCTTCGAAGTCAGTTCAGGGGGTTTTGGATGCTTTCTACAGATTTTCGCGGCCT
JMSF021M02- AACAGCCCTTCGAAGTCAGTTCAGGGGGTTTTGGATGCTTTCTACAGATTTTCGCGGCCT
                      ____________________________________________________________
consensus AACAGCCCTTCGAAGTCAGTTCAGGGGGTTTTGGATGCTTTCTACAGATTTTCGCGGCCT
 
. : . : . : . : . : . :
JMFF010I23- CATACGGTTATAGGAACAGCACTGAGCATACTTTCAGTTTCTCTTCTTGCAGTTGAGAAG
JMSF021A12- CATACGGTTATAGGAACAGCACTGAGCATACTTTCAGTTTCTCTTCTTGCAGTTGAGAAG
JMSF021M02- CATACGGTTATAGGAACAGCACTGAGCATACTTTCAGTTTCTCTTCTTGCAGTTGAGAAG
                      ____________________________________________________________
consensus CATACGGTTATAGGAACAGCACTGAGCATACTTTCAGTTTCTCTTCTTGCAGTTGAGAAG
 
. : . : . : . : . : . :
JMFF010I23- CTCTCAGATATTTCTCCATTATTTTTCACTGGGACGCTTGAGGCCATTGTTGCTGCCCTC
JMSF021A12- CTCTCAGATATTTCTCCATTATTTTTCACTGGGACGCTTGAGGCCATTGTTGCTGCCCTC
JMSF021M02- CTCTCAGATATTTCTCCATTATTTTTCACTGGGACGCTTGAGGCCATTGTTGCTGCCCTC
                      ____________________________________________________________
consensus CTCTCAGATATTTCTCCATTATTTTTCACTGGGACGCTTGAGGCCATTGTTGCTGCCCTC
 
. : . : . : . : . : . :
JMFF010I23- TTTATGAATATATACATAGTTGGTTTGAATCAGTTGTCTGATATTG
JMSF021A12- TTTATGAATATATACATAGTTGGTTTGAATCAGTTGTCTGATATTGAAATAGACAAGGTG
JMSF021M02- TTTATGAATATATACATAGTTGGTTTGAATCAGTTGTCTGATATTGAAATAGACAAGGTG
                      ____________________________________________________________
consensus TTTATGAATATATACATAGTTGGTTTGAATCAGTTGTCTGATATTGAAATAGACAAGGTG
 
. : . : . : . : . : . :
JMSF021A12- AACAAACCATATCTTCCATTAGCATCAGGCGAATATTCGGTGAAAACTGGCATAATGATC
JMSF021M02- AACAAACCATATCTTCCATTAGCATCAGGCGAATATTCGGTGAAAACTGGCATAATGATC
rJMSF021A12+ GGCATAATGATC
                      ____________________________________________________________
consensus AACAAACCATATCTTCCATTAGCATCAGGCGAATATTCGGTGAAAACTGGCATAATGATC
 
. : . : . : . : . : . :
JMSF021A12- GTTTCATCTTTTGCTGTTATGAGTT
JMSF021M02- GTTTCATCTTTTGCTGTTATGAGTTTTTGGCTTGCAAGTGCTGTTGGTTCTTGGCCGTT
rJMSF021A12+ GTTTCATCTTTTGCTGTTATGAGTTTTNGGCTTGCAAGTGCTGTTGGTTCTTGGCCGTTG
rJMSF015K23+ AAGTGCTGTTGGTTCTTGGCCGTTG
                      ____________________________________________________________
consensus GTTTCATCTTTTGCTGTTATGAGTTTTTGGCTTGCAAGTGCTGTTGGTTCTTGGCCGTTG
 
. : . : . : . : . : . :
rJMSF021A12+ TTTTGGGCTCTTTTCATCAGCTTTGGACTNGGAACTGCCTATTCAATCGATCTACCACTC
rJMSF015K23+ TTTTGGGCTCTTTTCATCAGCTTTGGACTTGGAACTGCCTATTCAATCGATCTACCACTC
rJMSF021M02+ TTCATCAGCTTTGGACTNGGAACTGCCTATTCAATCGATCTACCACTC
rJMFF010I23+ TTCATCAGCTTTGGACTTGGAACTGCCTATTCAATCGATCTACCACTC
                      ____________________________________________________________
consensus TTTTGGGCTCTTTTCATCAGCTTTGGACTTGGAACTGCCTATTCAATCGATCTACCACTC
 
. : . : . : . : . : . :
rJMSF021A12+ CTCAGGTGGAAGAGATTCGCTTTGGTTGCTGCGATGTGCATCCTTGCTGTGCGAGCTGTC
rJMSF015K23+ CTCAGGTGGAAGAGATTCGCTTTGGTTGCTGCGATGTGCATCCTTGCTGTGCGAGCTGTC
rJMSF021M02+ CTCAGGTGGAAGAGATTCGCTTTGGTTGCTGCGATGTGCATCCTTGCTGTGCGAGCTGTC
rJMFF010I23+ CTCAGGTGGAAGAGATTCGCTTTGGTTGCTGCGATGTGCATCCTTGCTGTGCGAGCTGTC
                      ____________________________________________________________
consensus CTCAGGTGGAAGAGATTCGCTTTGGTTGCTGCGATGTGCATCCTTGCTGTGCGAGCTGTC
 
. : . : . : . : . : . :
rJMSF021A12+ ATTGTTCAGATAGCATTCTATTTGCATATACAGACTCATGTTTATGGAAGACCGGTTGCC
rJMSF015K23+ ATTGTTCAGATAGCATTCTATTTGCATATACAGACTCATGTTTATGGAAGACCGGTTGCC
rJMSF021M02+ ATTGTTCAGATAGCATTCTATTTGCATATACAGACTCATGTTTATGGAAGACCGGTTGCC
rJMFF010I23+ ATTGTTCAGATAGCATTCTATTTGCATATACAGACTCATGTTTATGGAAGACCGGTTGCC
                      ____________________________________________________________
consensus ATTGTTCAGATAGCATTCTATTTGCATATACAGACTCATGTTTATGGAAGACCGGTTGCC
 
. : . : . : . : . : . :
rJMSF021A12+ TTTTCGAAACCTGTAATGTTTGCAACAGCATTCATGAGCTTCTTCTCGGTTGTTATTGCA
rJMSF015K23+ TTTTCGAAACCTGTAATGTTTGCAACAGCATTCATGAGCTTCTTCTCGGTTGTTATTGCA
rJMSF021M02+ TTTTCGAAACCTGTAATGTTTGCAACAGCATTCATGAGCTTCTTCTCGGTTGTTATTGCA
rJMFF010I23+ TTTTCGAAACCTGTAATGTTTGCAACAGCATTCATGAGCTTCTTCTCGGTTGTTATTGCA
                      ____________________________________________________________
consensus TTTTCGAAACCTGTAATGTTTGCAACAGCATTCATGAGCTTCTTCTCGGTTGTTATTGCA
 
. : . : . : . : . : . :
rJMSF021A12+ TTATTTAAGGACATTCCTGATATTGCTGGTGACAAGATCTTCGGAATTCGATCTTTTACT
rJMSF015K23+ TTATTTAAGGACATTCCTGATATTGCTGGTGACAAGATCTTCGGAATTCGATCTTTTACT
rJMSF021M02+ TTATTTAAGGACATTCCTGATATTGCTGGTGACAAGATCTTCGGAATTCGATCTTTTACT
rJMFF010I23+ TTATTTAAGGACATTCCTGATATTGCTGGTGACAAGATCTTCGGAATTCGATCTTTTACT
                      ____________________________________________________________
consensus TTATTTAAGGACATTCCTGATATTGCTGGTGACAAGATCTTCGGAATTCGATCTTTTACT
 
. : . : . : . : . : . :
rJMSF021A12+ GTTCGATTGGGCCAAGAAAGGGTCTTCTGGATTTGTATTTCACTACTTCAAATGGCTTAC
rJMSF015K23+ GTTCGATTGGGCCAAGAAAGGGTCTTCTGGATTTGTATTTCACTACTTCAAATGGCTTAC
rJMSF021M02+ GTTCGATTGGGCCAAGAAAGGGTCTTCTGGATTTGTATTTCACTACTTCAAATGGCTTAC
rJMFF010I23+ GTTCGATTGGGCCAAGAAAGGGTCTTCTGGATTTGTATTTCACTACTTCAAATGGCTTAC
                      ____________________________________________________________
consensus GTTCGATTGGGCCAAGAAAGGGTCTTCTGGATTTGTATTTCACTACTTCAAATGGCTTAC
 
. : . : . : . : . : . :
rJMSF021A12+ CTGGTCGCCATAGTGGTTGGAGCATCCTCCTCCTGTACCTGGAGCAAATATTTGACGGTT
rJMSF015K23+ CTGGTCGCCATAGTGGTTGGAGCATCCTCCTCCTGTACCTGGAGCAAATATTTGACGGTT
rJMSF021M02+ CTGGTCGCCATAGTGGTTGGAGCATCCTCCTCCTGTACCTGGAGCAAATATTTGACGGTT
rJMFF010I23+ CTGGTCGCCATAGTGGTTGGAGCATCCTCCTCCTGTACCTGGAGCAAATATTTGACGGTT
                      ____________________________________________________________
consensus CTGGTCGCCATAGTGGTTGGAGCATCCTCCTCCTGTACCTGGAGCAAATATTTGACGGTT
 
. : . : . : . : . : . :
rJMSF021A12+ ATTGGTCATGCTGCCTTGGCCTTGATACTTTGGACTCGTGCTAAAACAATTGACTTAAGC
rJMSF015K23+ ATTGGTCATGCTGCCTTGGCCTTGATACTTTGGACTCGTGCTAAAACAATTGACTTAAGC
rJMSF021M02+ ATTGGTCATGCTGCCTTGGCCTTGATACTTTGGACTCGTGCTAAAACAATTGACTTAAGC
rJMFF010I23+ ATTGGTCATGCTGCCTTGGCCTTGATACTTTGGACTCGTGCTAAAACAATTGACTTAAGC
                      ____________________________________________________________
consensus ATTGGTCATGCTGCCTTGGCCTTGATACTTTGGACTCGTGCTAAAACAATTGACTTAAGC
 
. : . : . : . : . : . :
rJMSF021A12+ AGAAAAGAAGCAATCACATCCTTCTACATGTTCATATGGAAGCTCTTCTACGCTGAGTAC
rJMSF015K23+ AGAAAAGAAGCAATCACATCCTTCTACATGTTCATATGGAAGCTCTTCTACGCTGAGTAC
rJMSF021M02+ AGAAAAGAAGCAATCACATCCTTCTACATGTTCATATGGAAGCTCTTCTACGCTGAGTAC
rJMFF010I23+ AGAAAAGAAGCAATCACATCCTTCTACATGTTCATATGGAAGCTCTTCTACGCTGAGTAC
                      ____________________________________________________________
consensus AGAAAAGAAGCAATCACATCCTTCTACATGTTCATATGGAAGCTCTTCTACGCTGAGTAC
 
. : . : . : . : . : . :
rJMSF021A12+ CTACTGATACCATTCGTGAGGTGAGCTTGGAAACCGCCATTAGAATTTGGCTCGCCGCAA
rJMSF015K23+ CTACTGATACCATTCGTGAGGTGAGCTTGGAAACCGCCATTAGAATTTGGCTCGCCGCAA
rJMSF021M02+ CTACTGATACCATTCGTGAGGTGAGCTTGGAAACCGCCATTAGAATTTGGCTCGCCGCAA
rJMFF010I23+ CTACTGATACCATTCGTGAGGTGAGCTTGGAAACCGCCATTAGAATTTGGCTCGCCGCAA
                      ____________________________________________________________
consensus CTACTGATACCATTCGTGAGGTGAGCTTGGAAACCGCCATTAGAATTTGGCTCGCCGCAA
 
. : . : . : . : . : . :
rJMSF021A12+ GATGCTTAGTGTGTTAGACTGTTAGGTTGATCTTGCTTGTAAATTCTGTTATTAGAACAC
rJMSF015K23+ GATGCTTAGTGTGTTAGACTGTTAGGTTGATCTTGCTTGTAAATTCTGTTATTAGAACAC
rJMSF021M02+ GATGCTTAGTGTGTTAGACTGTTAGGTTGATCTTGCTTGTAAATTCTGTTATTAGAACAC
rJMFF010I23+ GATGCTTAGTGTGTTAGACTGTTAGGTTGATCTTGCTTGTAAATTCTGTTATTAGAACAC
                      ____________________________________________________________
consensus GATGCTTAGTGTGTTAGACTGTTAGGTTGATCTTGCTTGTAAATTCTGTTATTAGAACAC
 
. : . : . : . : . : . :
rJMSF021A12+ CCAAAGGTGTGTGCTTTTTGTCAACTTCATCGTTTCCATCTTCACAATTTGATTTGGCTC
rJMSF015K23+ CCAAAGGTGTGTGCTTTTTGTCAACTTCATCGTTTCCATCTTCACAATTTGATTTGGCTC
rJMSF021M02+ CCAAAGGTGTGTGCTTTTTGTCAACTTCATCGTTTCCATCTTCACAATTTGATTTGGCTC
rJMFF010I23+ CCAAAGGTGTGTGCTTTTTGTCAACTTCATCGTTTCCATCTTCACAATTTGATTTGGCTC
                      ____________________________________________________________
consensus CCAAAGGTGTGTGCTTTTTGTCAACTTCATCGTTTCCATCTTCACAATTTGATTTGGCTC
 
. : . : . : . : . : . :
rJMSF021A12+ TCAA-TTGGATAAGG
rJMSF015K23+ TCAA-TTGGATAAGG
rJMSF021M02+ TCAATT
rJMFF010I23+ TCAATTTGGATAAGGTGTTATGTTATGAACAAATTAAATATTGGTCTTGTTTGGTAAAAT
                      ____________________________________________________________
consensus TCAATTTGGATAAGGTGTTATGTTATGAACAAATTAAATATTGGTCTTGTTTGGTAAAAT