Previous Contig 008653:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010I11Sequence543000096 (11)gb:AF286719_17832132e-50Arabidopsis thaliana XRN3 (XRN3) mRNA, complete cds.780008653 (3)gb:AP004669_18430120.002Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMFF020C18Sequence536000096 (11)gb:AF286719_17832134e-50Arabidopsis thaliana XRN3 (XRN3) mRNA, complete cds.671008653 (3)gb:AP004669_18430120.003Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049
JMFF051L10Sequence522000096 (11)gb:AF286719_17832132e-47Arabidopsis thaliana XRN3 (XRN3) mRNA, complete cds.446008653 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010I11+ ATGATGATAATCATAGCCAGACTAATGCTTATTCGGGCTCTCATCATGCNTACAGGAGGC
                      ____________________________________________________________
consensus ATGATGATAATCATAGCCAGACTAATGCTTATTCGGGCTCTCATCATGCNTACAGGAGGC
 
. : . : . : . : . : . :
rJMFF020C18+ CATCATGAAAGGATTGACCAATCTGTTGCCCAGAGTAGGGATTATCATAGAC
rJMFF010I11+ NTAATCCTCATCATGAAAGGATTGACCAATCTGTTGCCCAGAGTAGGGATTATCATAGAC
                      ____________________________________________________________
consensus NTAATCCTCATCATGAAAGGATTGACCAATCTGTTGCCCAGAGTAGGGATTATCATAGAC
 
. : . : . : . : . : . :
rJMFF020C18+ ATGGATATTATGCACCAGGGTTGCAGCACAATGGGGGACACTCCTACCACTCAGGTGCCA
rJMFF010I11+ ATGGATATTATGCACCAGGGTTGCAGCACAATGGGGGACACTCCTACCACTCAGGTGCCA
                      ____________________________________________________________
consensus ATGGATATTATGCACCAGGGTTGCAGCACAATGGGGGACACTCCTACCACTCAGGTGCCA
 
. : . : . : . : . : . :
rJMFF020C18+ CACACCATCAACATGTGCACTTAACTCCCCATCCACCACCAACTCATATACCCAATCACA
rJMFF010I11+ CACACCATCAACATGTGCACTTAACTCCCCATCCACCACCAACTCATATACCCAATCACA
                      ____________________________________________________________
consensus CACACCATCAACATGTGCACTTAACTCCCCATCCACCACCAACTCATATACCCAATCACA
 
. : . : . : . : . : . :
rJMFF020C18+ GAGGATATAATCATCAACCTTACGAGTCTGGTAGTTATAATCATTTGGGCAGTGGTCAAG
rJMFF051L10+ TTGGGCAGTGGTCAAG
rJMFF010I11+ GAGGATATAATCATCAACCTTACGAGTCTGGTAGTTATAATCATTTGGGCAGTGGTCAAG
                      ____________________________________________________________
consensus GAGGATATAATCATCAACCTTACGAGTCTGGTAGTTATAATCATTTGGGCAGTGGTCAAG
 
. : . : . : . : . : . :
rJMFF020C18+ GTCCTCATAGCAACCCAGGTGGTGGCAGAGGATATAATTATCCACACCAATCAAGCAATC
rJMFF051L10+ GTCCTCATAGCAACCCAGGTGGTGGCAGAGGATATAATTATCCACACCAATCAAGCAATC
rJMFF010I11+ GTCCTCATAGCAACCCAGGTGGTGGCAGAGGATATAATTATCCACACCAATCAAGCAATC
                      ____________________________________________________________
consensus GTCCTCATAGCAACCCAGGTGGTGGCAGAGGATATAATTATCCACACCAATCAAGCAATC
 
. : . : . : . : . : . :
rJMFF020C18+ AATATGCAGCTTTAAATAGGGGATCAAATAGACGACCACCTTCTGACTATCGGCGCTAGA
rJMFF051L10+ AATATGCAGCTTTAAATAGGGGATCAAATAGACGACCACCTTTTGACTATCGGCGCTAGA
rJMFF010I11+ AATATGCAGCTTTAAATAGGGGATCAAATAGACGACCACCTTCTGACTATCGGCGCTAGA
                      ____________________________________________________________
consensus AATATGCAGCTTTAAATAGGGGATCAAATAGACGACCACCTTCTGACTATCGGCGCTAGA
 
. : . : . : . : . : . :
rJMFF020C18+ GGGGTAGTATTTTAGCTTTGGACTTCTCAGTTTAACCTTTGTAGCTTTGAATTTGATGTT
rJMFF051L10+ GGGGTAGTATTTTAGCTTTGGACTTCTCAGTTTAACCTTTGTATCTTTGAATTTGATGTT
rJMFF010I11+ GGGGTAGTATTTTAGCTTTGGACTTCTCAGTTTAACCTTTGTAGCTTTGAATTTGATGTT
                      ____________________________________________________________
consensus GGGGTAGTATTTTAGCTTTGGACTTCTCAGTTTAACCTTTGTAGCTTTGAATTTGATGTT
 
. : . : . : . : . : . :
rJMFF020C18+ ACATCAACTCACCAAGCAGATGTATGGAGCCAGGGGAGGATGGATCATCAGTGTTGCCTG
rJMFF051L10+ ACATCAACTCACCAAGCAGATGTATGGAGCCAGGGGAGGATGGATCATCAGTGTTGCCTG
rJMFF010I11+ ACATCAACTCACCAAGCAGATGTATGGAGCCAGGGGAGGATGGATCATCAGTGTTGCCTG
                      ____________________________________________________________
consensus ACATCAACTCACCAAGCAGATGTATGGAGCCAGGGGAGGATGGATCATCAGTGTTGCCTG
 
. : . : . : . : . : . :
rJMFF020C18+ GAGCAATTGCTTGCCGATCTGTTTTGTGCTTAGCTTTGTAATTTGTACCATAGTGTCTCA
rJMFF051L10+ GAGCAATTGCTTGCCGATCTGTTTTGTGCTTAGCTTTGTAATTTGTACCATAGTGTCTCA
rJMFF010I11+ GAGCAATTGCTTGCCGATCTGTTTTGTGCTTAGCTTTGTAATTTGTACCATAGTGTCTCA
                      ____________________________________________________________
consensus GAGCAATTGCTTGCCGATCTGTTTTGTGCTTAGCTTTGTAATTTGTACCATAGTGTCTCA
 
. : . : . : . : . : . :
rJMFF020C18+ TTACCTCATTATTTTTATGTTATATTTGTTTTTTTCTAAAGATATAAATTTAATGTACTT
rJMFF051L10+ TTACCTCATTATTTTTATGTTATATTTGTTTTTTTCTAAAGATATAAATTTAATGTACTT
rJMFF010I11+ TTACCTCATTATTTTTATGTTATATTTGTTTTTTTCTAAAGATATAAATTTAATGTACTT
                      ____________________________________________________________
consensus TTACCTCATTATTTTTATGTTATATTTGTTTTTTTCTAAAGATATAAATTTAATGTACTT
 
. : . : . : . : . : . :
rJMFF020C18+ CAATTTGTTGTAACCGGTTACTGATTGACGGGAAAGGTTGTAATCTTGGATAAAAGTTTT
rJMFF051L10+ CAATTTGTTGTAACCGGTTACTGATTGACGGGAAAGGTTGTAATCTTGGATAAAAGTTTT
rJMFF010I11+ CAATTTGTTGTAACCGGTTACTGATTGACGGGAAAGGTTGTAATCTTGGATAAAAGTTTT
                      ____________________________________________________________
consensus CAATTTGTTGTAACCGGTTACTGATTGACGGGAAAGGTTGTAATCTTGGATAAAAGTTTT
 
. : . : . : . : . : . :
rJMFF020C18+ TGTATTCCGTTGAATCATT
rJMFF051L10+ TGT
rJMFF010I11+ TGTATTCCGTTGAATCATTTGAACCAATTGTTAGTTTGTTATGGGAATGAGAAGCGAGCA
                      ____________________________________________________________
consensus TGTATTCCGTTGAATCATTTGAACCAATTGTTAGTTTGTTATGGGAATGAGAAGCGAGCA