Previous Contig 008651:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010I04Sequence563008651 (14)gb:CQ834923_14541181e-67Sequence 2 from Patent WO2004058956.811008651 (14)gb:CQ834923_14541184e-78Sequence 2 from Patent WO2004058956.
JMFF013P09Sequence525008651 (14)gb:CQ834923_14541184e-58Sequence 2 from Patent WO2004058956.768008651 (14)gb:CQ834923_14541188e-80Sequence 2 from Patent WO2004058956.
JMFF016O16Sequence539008651 (14)gb:CQ834923_14541181e-90Sequence 2 from Patent WO2004058956.801008651 (14)gb:CQ834923_14541186e-81Sequence 2 from Patent WO2004058956.
JMFF026L07Sequence542008651 (14)gb:CQ834923_14541184e-58Sequence 2 from Patent WO2004058956.788008651 (14)gb:CQ834923_14541189e-75Sequence 2 from Patent WO2004058956.
JMFF032I20Sequence166008651 (14)
JMFF037P23Sequence545008651 (14)gb:CQ834923_14541183e-62Sequence 2 from Patent WO2004058956.672008651 (14)gb:CQ834923_14541185e-73Sequence 2 from Patent WO2004058956.
JMFF040P14Sequence469008651 (14)gb:CQ834923_14541183e-42Sequence 2 from Patent WO2004058956.779008651 (14)gb:CQ834923_14541182e-77Sequence 2 from Patent WO2004058956.
JMSF040F19Sequence780008651 (14)gb:CQ834923_1454118e-132Sequence 2 from Patent WO2004058956.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF026L07- GATTTCCCATTCCGTTCATTCCTCACCCGAACTACCGATTTCCC
JMFF040P14- CTCACCCGAACTACCGATTTCCC
JMFF013P09- CTCACCCGAACTACCGATTTCCC
JMFF037P23- CTCACCCGAACTACCGATTTCCC
JMFF010I04- GAACTACCGATTTCCC
                      ____________________________________________________________
consensus GATTTCCCATTCCGTTCATTCCTCACCCGAACTACCGATTTCCC
 
. : . : . : . : . : . :
JMFF026L07- TCTTCTTTCACATACAACGCTTTTGTATAATAATCTCCTTTTCACGCTGATCGCAACACA
JMFF040P14- TCTTCTTTCACATACAACGCTTTTGTATAATAATCTCCTTTTCACGCTGATCGCAACACA
JMFF013P09- TCTTCTTTCACATACAACGCTTTTGTATAATAATCTCCTTTTCACGCTGATCGCAACACA
JMFF037P23- TCTTCTTTCACATACAACGCTTTTGTATAATAATCTCCTTTTCACGCTGATCGCAACACA
JMFF010I04- TCTTCTTTCACATACAACGCTTTTGTATAATAATCTCCTTTTCACGCTGATCGCAACACA
                      ____________________________________________________________
consensus TCTTCTTTCACATACAACGCTTTTGTATAATAATCTCCTTTTCACGCTGATCGCAACACA
 
. : . : . : . : . : . :
JMFF026L07- CAAAACGCAGAAATATGCAGCGCCGTGCAGATATCAATCGAAGAATCGCCCGAATTTCAG
JMFF040P14- CAAAACGCAGAAATATGCAGCGCCGTGCAGATATCAATCGAAGAATCGCCCGAATTTCAG
JMFF013P09- CAAAACGCAGAAATATGCAGCGCCGTGCAGATATCAATCGAAGAATCGCCCGAATTTCAG
JMFF037P23- CAAAACGCAGAAATATGCAGCGCCGTGCAGATATCAATCGAAGAATCGCCCGAATTTCAG
JMFF010I04- CAAAACGCAGAAATATGCAGCGCCGTGCAGATATCAATCGAAGAATCGCCCGAATTTCAG
                      ____________________________________________________________
consensus CAAAACGCAGAAATATGCAGCGCCGTGCAGATATCAATCGAAGAATCGCCCGAATTTCAG
 
. : . : . : . : . : . :
JMFF026L07- CTCACCTCTGCCCTTCTTCTGATTCCCAGATGGAGGGGAGTTCTGGGTTGGGGATGGCGA
JMFF040P14- CTCACCTCTGCCCTTCTTCTGATTCCCAGATGGAGGGGAGTTCTGGGTTGGGGATGGCGA
JMFF013P09- CTCACCTCTGCCCTTCTTCTGATTCCCAGATGGAGGGGAGTTCTGGGTTGGGGATGGCGA
JMFF037P23- CTCACCTCTGCCCTTCTTCTGATTCCCAGATGGAGGGGAGTTCTGGGTTGGGGATGGCGA
JMFF010I04- CTCACCTCTGCCCTTCTTCTGATTCCCAGATGGAGGGGAGTCCTGGGTTGGGGATGGCGA
                      ____________________________________________________________
consensus CTCACCTCTGCCCTTCTTCTGATTCCCAGATGGAGGGGAGTTCTGGGTTGGGGATGGCGA
 
. : . : . : . : . : . :
JMFF026L07- ATTGCAGGGCTAAAGGGGGATCGCCCGGATTCAAAGTTGCGATTTTGGGTGCTGCAGGGG
JMFF040P14- ATTGCAGGGCTAAAGGGGGATCGCCCGGATTCAAAGTTGCGATTTTGGGTGCTGCAGGGG
JMFF013P09- ATTGCAGGGCTAAAGGGGGATCGCCCGGATTCAAAGTTGCGATTTTGGGTGCTGCAGGGG
JMFF037P23- ATTGCAGGGCTAAAGGGGGATCGCCCGGATTCAAAGTTGCGATTTTGGGTGCTGCAGGGG
JMFF010I04- ATTGCAGGGCTAAAGGGGGATCGCCCGGATTCAAAGTTGCGATTTTGGGTGCTGCAGGGG
                      ____________________________________________________________
consensus ATTGCAGGGCTAAAGGGGGATCGCCCGGATTCAAAGTTGCGATTTTGGGTGCTGCAGGGG
 
. : . : . : . : . : . :
JMFF026L07- GTATAGGCCAGCCTCTTGCTTTGCTCATGAAGATGAATCCACTGGTTTCAGTTCTGCATC
JMFF040P14- GTATAGGCCAGCCTCTTGCTTTGCTCATGAAGATGAATCCACTGGTTTCAGTTCTGCATC
JMFF013P09- GTATAGGCCAGCCTCTTGCTTTGCTCATGAAGATGAATCCACTGGTTTCAGTTCTGCATC
JMFF037P23- GTATAGGCCAGCCTCTTGCTTTGCTCATGAAGATGAATCCACTGGTTTCAGTTCTGCATC
JMFF010I04- GTATAGGCCAGCCTCTTGCTTTGCTCATGAAGATGAATCCACTGGTTTCAGTTCTGCATC
                      ____________________________________________________________
consensus GTATAGGCCAGCCTCTTGCTTTGCTCATGAAGATGAATCCACTGGTTTCAGTTCTGCATC
 
. : . : . : . : . : . :
JMFF026L07- TCTATGATGTGGTGAATACGCCCGGTGTTACAGCTGATATCAGCCACATGGACACTGGTG
JMFF040P14- TCTATGATGTGGTGAATACGCCCGGTGTTACAGCTGATATCAGCCACATGGACACTGGTG
JMFF013P09- TCTATGATGTGGTGAATACGCCCGGTGTTACAGCTGATATCAGCCACATGGACACTGGTG
JMFF037P23- TCTATGATGTGGTGAATACGCCCGGTGTTACAGCTGATATCAGCCACATGGACACTGGTG
JMFF010I04- TCTATGATGTGGTGAATACGCCCGGTGTTACAGCTGATATCAGCCACATGGACACTGGTG
rJMSF040F19+ TGTTACAGCTGATNTCAGCCACATGGACACTGGTG
                      ____________________________________________________________
consensus TCTATGATGTGGTGAATACGCCCGGTGTTACAGCTGATATCAGCCACATGGACACTGGTG
 
. : . : . : . : . : . :
JMFF026L07- CAGTGGTGCGTGGTTTTTTGGGGCCACAACAGTTGGAGAATGCTCTCACTGGCAT-GGAT
JMFF040P14- CAGTGGTGCGTGGTTTTTTGGGGCCACAACAGTTGGAGAATGCTCTCACTGGCATGGGAT
JMFF013P09- CAGTGGTGCGTGGTTTTTTGGGGCCACAACAGTTGGAGAATGCTCTCACTGGCAT-GGAT
JMFF037P23- CAGTGGTGCGTGGTTTTTTGGGGCCACAACAGTTGGAGAATGCTCTCACTGGCAT-GGAT
JMFF010I04- CAGTGGTGCGTGGTTTTTTGGGGCCACAACAGTTGGAGAATGCTCTCACTGGCAT-GGAT
rJMSF040F19+ CAGTGGTGCGTGGTTTTTTGGGGCCACAACAGTTGGAGAATGCTCTCACTGGCAT-GGAT
                      ____________________________________________________________
consensus CAGTGGTGCGTGGTTTTTTGGGGCCACAACAGTTGGAGAATGCTCTCACTGGCAT-GGAT
 
. : . : . : . : . : . :
JMFF026L07- CTTGTAGTCATTCCTGCTGGTGTTCCTAGAAAACCAGGAATGACGAGGGATGATCTTTTC
JMFF040P14- CTCGTAGTCATTCCTGCTGGTG
JMFF013P09- CTTGTAGTCATTCCTGCTGGTGTTCCTAGAAAACCAGGAATGACGAGGGATGATCTTTTC
JMFF037P23- CTTGTAGTCATTCCTGCTGGTGTTCCTAGAAAACCAGGAATGACGAGGGATGATCTTTTC
JMFF010I04- CTTGTAGTCATTCCTGCTGGTGTTCCTAGAAAACCAGGAATGACGAGGGATGATCTTTTC
rJMSF040F19+ CTNGTAGTCATTCCTGCTGGTGTTCCTAGAAAACCAGGAATGACGAGGGATGATCTTTTC
                      ____________________________________________________________
consensus CTTGTAGTCATTCCTGCTGGTGTTCCTAGAAAACCAGGAATGACGAGGGATGATCTTTTC
 
. : . : . : . : . : . :
JMFF026L07- AACATTAATGCCGGAATAG
JMFF013P09- AACATTAATGCCGGAATAG
JMFF037P23- AACATTAATGCCGGAATAGTTAAGACCTTATGTGAAGGA
JMFF010I04- AACATTAATGCCGGAATAGTTAAGACCTTATGTGAAGGAATCGCAAAGTGCTGTCCCAAA
JMFF016O16- AATAGTTAAGACCTTATGTGAAGGAATCGCAAAGTGCTGTCCCAAA
rJMSF040F19+ AACATTAATGCCGGAATAGTTAAGACCTTATGTGAAGGAATCGCAAAGTGCTGTCCCAAA
                      ____________________________________________________________
consensus AACATTAATGCCGGAATAGTTAAGACCTTATGTGAAGGAATCGCAAAGTGCTGTCCCAAA
 
. : . : . : . : . : . :
JMFF010I04- GCCA
JMFF016O16- GCCATTGTCAATGTAATTAGTAATCCTGTAAACTCAACTGTTCCAATTGCAGCTGAGGTT
rJMSF040F19+ GCCATTGTCAATGTAATTAGTAATCCTGTAAACTCAACTGTTCCAATTGCAGCTGAGGTT
rJMFF013P09+ TT
                      ____________________________________________________________
consensus GCCATTGTCAATGTAATTAGTAATCCTGTAAACTCAACTGTTCCAATTGCAGCTGAGGTT
 
. : . : . : . : . : . :
JMFF016O16- TTCAAAAGGGCTGGAACTTACGAT-CCCAAGCTGCTTTTGGGAGTGACAAAGCTTGATGT
rJMSF040F19+ TTCAAAAGGGCTGGAACTTACGAT-CCCAAGCTGCTTTTGGGAGTGACAAAGCTTGATGT
rJMFF013P09+ TTCAAAAGGGCTGGAACTTACGATCCCCAAGCTGCTTTTGGGAGTGACAAAGCTTGATGT
rJMFF016O16+ TGGGAGTGACAAAGCTTGATGT
rJMFF026L07+ AAGCTTGATGT
rJMFF040P14+ TTTTGGGAGTGACAAAGCTTGATGT
rJMFF010I04+ AGCTGCTTTTGGGAGTGACAAAGCTTGATGT
                      ____________________________________________________________
consensus TTCAAAAGGGCTGGAACTTACGAT-CCCAAGCTGCTTTTGGGAGTGACAAAGCTTGATGT
 
. : . : . : . : . : . :
JMFF016O16- AGTGAGAGCCAATACATTTGTGGCTGAAGTTTTGGGGCTTGATCCAAGGGAAGTGGATGT
rJMSF040F19+ AGTGAGAGCCAATACATTTGTGGCTGAAGTTTTGGGGCTTGATCCAAGGGAAGTGGATGT
rJMFF037P23+ TTTTGGGGCTTGATCCAAGGGAAGTGGATGT
rJMFF013P09+ AGTGAGAGCCAATACATTTGTGGCTGAAGTTTTGGGGCTTGATCCAAGGGAAGTGGATGT
rJMFF016O16+ AGTGAGAGCCAATACATTTGTGGCTGAAGTTTTGGGGCTTGATCCAAGGGAAGTGGATGT
rJMFF026L07+ AGTGAGAGCCAATACATTTGTGGCTGAAGTTTTGGGGCTTGATCCAAGGGAAGTGGATGT
rJMFF040P14+ AGTGAGAGCCAATACATTTGTGGCTGAAGTTTTGGGGCTTGATCCAAGGGAAGTGGATGT
rJMFF010I04+ AGTGAGAGCCAATACATTTGTGGCTGAAGTTTTGGGGCTTGATCCAAGGGAAGTGGATGT
                      ____________________________________________________________
consensus AGTGAGAGCCAATACATTTGTGGCTGAAGTTTTGGGGCTTGATCCAAGGGAAGTGGATGT
 
. : . : . : . : . : . :
JMFF016O16- TCCGGTTGTAGGTGGTCATGCTGGAGTTACAATTTTACCTCTTTTGTCTCAGGTTAAACC
rJMSF040F19+ TCCGGTTGTAGGTGGTCATGCTGGAGTTACAATTTTACCTCTTTTGTCTCAGGTTAAACC
rJMFF037P23+ TCCGGTTGTAGGTGGTCATGCTGGAGTTACAATTTTACCTCTTTTGTCTCAGGTTAAACC
rJMFF013P09+ TCCGGTTGTAGGTGGTCATGCTGGAGTTACAATTTTACCTCTTTTGTCTCAGGTTAAACC
rJMFF016O16+ TCCGGTTGTAGGTGGTCATGCTGGAGTTACAATTTTACCTCTTTTGTCTCAGGTTAAACC
rJMFF026L07+ TCCGGTTGTAGGTGGTCATGCTGGAGTTACAATTTTACNTCTTTTGTCTCAGGTTAAACC
rJMFF040P14+ TCCGGTTGTAGGTGGTCATGCTGGAGTTACAATTTTACCTCTTTTGTCTCAGGTTAAACC
rJMFF010I04+ TCCGGTTGTAGGTGGTCATGCTGGAGTTACAATTTTACCTCTTTTGTCTCAGGTTAAACC
                      ____________________________________________________________
consensus TCCGGTTGTAGGTGGTCATGCTGGAGTTACAATTTTACCTCTTTTGTCTCAGGTTAAACC
 
. : . : . : . : . : . :
JMFF016O16- TCCATGTT-CTTTGTCCCCCGAGGAAACCGAGTATCTGACCTCCCGTATTCAGAATGGGG
rJMSF040F19+ TCCATGTT-CTTTGTCCCCCGAGGAAACCGAGTATCTGACCTCCCGTATTCAGAATGGGG
rJMFF037P23+ TCCATGTT-CTTTGTCCCCCGAGGAAACCGAGTATCTGACCTCCCGTATTCAGAATGGGG
rJMFF013P09+ TCCATGTTTCTTTGTCCCCCGAGGAAACCGAGTATCTGACCTCCCGTATTCAGAATGGGG
rJMFF016O16+ TCCATGTTNC-TTGTCCCCCGAGGAAACCGAGTATCTGACCTCCCGTATTCAGAATGGGG
rJMFF026L07+ TCCATGTTTCTTTGTCCCCCGAGGAAACCGAGTATCTGACCTCCCGTATTCAGAATGGGG
rJMFF040P14+ TCCATGTTTCTTTGTCCCCCGAGGAAACCGAGTATCTGACCTCCCGTATTCAGAATGGGG
rJMFF010I04+ TCCATGTTNCTTTGTCCCCCGAGGAAACCGAGTATCTGACCTCCCGTATTCAGAATGGGG
                      ____________________________________________________________
consensus TCCATGTTTCTTTGTCCCCCGAGGAAACCGAGTATCTGACCTCCCGTATTCAGAATGGGG
 
. : . : . : . : . : . :
JMFF016O16- GCACAGAAGTTGTTGAGGCAAAGGCTGGTGCGGGATCTGCAACTCTGTCTATGGCATATG
rJMSF040F19+ GCACAGAAGTTGTTGAGGCAAAGGCTGGTGCGGGATCTGCAACTCTGTCTATGGCATATG
rJMFF037P23+ GCACAGAAGTTGTTGAGGCAAAGGCTGGTGCGGGATCTGCAACTCTGTCTATGGCATATG
rJMFF013P09+ GCACAGAAGTTGTTGAGGCAAAGGCTGGTGCGGGATCTGCAACTCTGTCTATGGCATATG
rJMFF016O16+ GCACAGAAGTTGTTGAGGCAAAGGCTGGTGCGGGATCTGCAACTCTGTCTATGGCATATG
rJMFF026L07+ GCACAGAAGTTGTTGAGGCAAAGGCTGGTGCGGGATCTGCAACTCTGTCTATGGCATATG
rJMFF040P14+ GCACAGAAGTTGTTGAGGCAAAGGCTGGTGCGGGATCTGCAACTCTGTCTATGGCATATG
rJMFF010I04+ GCACAGAAGTTGTTGAGGCAAAGGCTGGTGCGGGATCTGCAACTCTGTCTATGGCATATG
                      ____________________________________________________________
consensus GCACAGAAGTTGTTGAGGCAAAGGCTGGTGCGGGATCTGCAACTCTGTCTATGGCATATG
 
. : . : . : . : . : . :
JMFF016O16- CAGCTGTTAAATTCGCAGATGCGTGCTTGCGAGGATTAAGAGGGGATGCTGGAGTTGTCG
rJMSF040F19+ CAGCTGTTAAATTCGCAGATGCGTGCTTGCGAGGATTAAGAGGGGATGCTGGAGTTGTCG
rJMFF037P23+ CAGCTGTTAAATTCGCAGATGCGTGCTTGCGAGGATTAAGAGGGGATGCTGGAGTTGTCG
rJMFF013P09+ CAGCTGTTAAATTCGCAGATGCGTGCTTGCGAGGATTAAGAGGGGATGCTGGAGTTGTCG
rJMFF016O16+ CAGCTGTTAAATTCGCAGATGCGTGCTTGCGAGGATTAAGAGGGGATGCTGGAGTTGTCG
rJMFF026L07+ CAGCTGTTAAATTCGCAGATGCGTGCTTGCGAGGATTAAGAGGGGATGCTGGAGTTGTCG
rJMFF040P14+ CAACTGTTAAATTCGCAGATGCGTGCTTGCGAGGATTAAGAGGGGATGCTGGAGTTGTCG
rJMFF010I04+ CAGCTGTTAAATTCGCAGATGCGTGCTTGCGAGGATTAAGAGGGGATGCTGGAGTTGTCG
                      ____________________________________________________________
consensus CAGCTGTTAAATTCGCAGATGCGTGCTTGCGAGGATTAAGAGGGGATGCTGGAGTTGTCG
 
. : . : . : . : . : . :
JMFF016O16- AATGTGCCTATGTGTCTTCCCAGGTGACTGAGCTTCCTTTCTTTGCATCCAAAGTATTGC
rJMSF040F19+ AATGTGCCTATGTGTCTTCCCAGGTGACTGAGCTTCCTTTCTTTGCATCCAAAGTATTGC
rJMFF037P23+ AATGTGCCTATGTGTCTTCCCAGGTGACTGAGCTTCCTTTCTTTGCATCCAAAGTATTGC
rJMFF013P09+ AATGTGCCTATGTGTCTTCCCAGGTGACTGAGCTTCCTTTCTTTGCATCCAAAGTATTGC
rJMFF016O16+ AATGTGCCTATGTGTCTTCCCAGGTGACTGAGCTTCCTTTCTTTGCATCCAAAGTATTGC
rJMFF026L07+ AATGTGCCTATGTGTCTTCCCAGGTGACTGAGCTTCCTTTCTTTGCATCCAAAGTATTGC
rJMFF040P14+ AATGTGCCTATGTGTCTTCCCAGGTGACTGAGCTTCCTTTCTTTGCATCCAAAGTATTGC
rJMFF010I04+ AATGTGCCTATGTGTCTTCCCAGGTGACTGAGCTTCCTTTCTTTGCATCCAAAGTATTGC
                      ____________________________________________________________
consensus AATGTGCCTATGTGTCTTCCCAGGTGACTGAGCTTCCTTTCTTTGCATCCAAAGTATTGC
 
. : . : . : . : . : . :
JMFF016O16- TCGGCCGCAATGGAG
rJMSF040F19+ TCGGCCGCAATGGAGTTGAAGAGATTTACTCACTTGGTCCCCTGAATGACTATGAAAGGG
rJMFF037P23+ TCGGCCGCAATGGAGTTGAAGAGATTTACTCACTTGGTCCCCTGAATGACTATGAAAGGG
rJMFF013P09+ TCGGCCGCAATGGAGTTGAAGAGATTTACTCACTTGGTCCCCTGAATGACTATGAAAGGG
rJMFF016O16+ TCGGCCGCAATGGAGTTGAAGAGATTTACTCACTTGGTCCCCTGAATGACTATGAAAGGG
rJMFF026L07+ TCGGCCGCAATGGAGTTGAAGAGATTTACTCACTTGGTCCCCTGAATGACTATGAAAGGG
rJMFF040P14+ TCGGCCGCAATGGAGTTGAAGAGATTTACTCACTTGGTCCCCTGAATGACTATGAAAGGG
rJMFF010I04+ TCGGCCGCAATGGAGTTGAAGAGATTTACTCACTTGGTCCCCTGAATGACTATGAAAGGG
                      ____________________________________________________________
consensus TCGGCCGCAATGGAGTTGAAGAGATTTACTCACTTGGTCCCCTGAATGACTATGAAAGGG
 
. : . : . : . : . : . :
rJMSF040F19+ CTGGGCTGCAAA
rJMFF037P23+ CTGGGCTGCAAAAGGCACAAGAAGAGCTAGCAGCAAGTATTCAGAAGGGTGTCACATTTA
rJMFF013P09+ CTGGGCTGCAAAAGGCACAAGAAGAGCTAGCAGCAAGTATTCAGAAGGGTGTCACATTTA
rJMFF016O16+ CTGGGCTGCAAAAGGCACAAGAAGAGCTAGCAGCAAGTATTCAGAAGGGTGTCACATTTA
rJMFF026L07+ CTGGGCTGCAAAAGGCACAAGAAGAGCTAGCAGCAAGTATTCAGAAGGGTGTCACATTTA
rJMFF040P14+ CTGGGCTGCAAAAGGCACAAGAAGAGCTAGCAGCAAGTATTCAGAAGGGTGTCACATTTA
rJMFF032I20+ AGCTAGCAGCAAGTATTCAGAAGGGTCTCACATTTA
rJMFF010I04+ CTGGGCTGCAAAAGGCACAAGAAGAGCTAGCAGCAAGTATTCAGAAGGGTGTCACATTTA
                      ____________________________________________________________
consensus CTGGGCTGCAAAAGGCACAAGAAGAGCTAGCAGCAAGTATTCAGAAGGGTGTCACATTTA
 
. : . : . : . : . : . :
rJMFF037P23+ TAAGAAAATGATGAGTTAGACTTGTCTGGTAGATGCCTTGGATGGGTCTTTGTAATAAAG
rJMFF013P09+ TAAGAAAATGATGAGTTAGACTTGTCTGGTAGATGCCTTGGATGGGTCTTTGTAATAAAG
rJMFF016O16+ TAAGAAAATGATGAGTTAGACTTGTCTGGTAGATGCCTTGGATGGGTCTTTGTAATAAAG
rJMFF026L07+ TAAGAAAATGATGAGTTAGACTTGTCTGGTAGATGCCTTGGATGGGTCTTTGTAATAAAG
rJMFF040P14+ TAAGAAAATGATGAGTTAGACTTGTCTGGTAGATGCCTTGGATGGGTCTTTGTAATAAAG
rJMFF032I20+ TAAGAAAATNATGAGTTAGNCTCGTNTGGTAGATNCCTAGGATGGGTNTNNGTAATAAAG
rJMFF010I04+ TAAGAAAATGATGAGTTAGACTTGTCTGGTAGATGCCTTGGATGGGTCTTTGTAATAAAG
                      ____________________________________________________________
consensus TAAGAAAATGATGAGTTAGACTTGTCTGGTAGATGCCTTGGATGGGTCTTTGTAATAAAG
 
. : . : . : . : . : . :
rJMFF037P23+ TTTTTATGTTTATGATTATCAGAATAATATCATTATATCCTTGTAATAAAAGGGGAAAGA
rJMFF013P09+ TTTTTATGTTTATGATTATCAGAATAATATCATTATATCCTTGTAATAAAAGGGGAAAGA
rJMFF016O16+ TTTTTATGTTTATGATTATCAGAATAATATCATTATATCCTTGTAATAAAAGGGGAAAGA
rJMFF026L07+ TTTTTATGTTTATGATTATCAGAATAATATCATTATATCCTTGTAATAAAAGGGGAAAGA
rJMFF040P14+ TTTTTATGTTTATGATTATCAGAATAATATCATTATATCCTTGTAATAAAAGGGGAAAGA
rJMFF032I20+ TTNTNANGTTTATGATTATCAGAATAATATCATNNNATCCTCGTAATAAAAGGGGAAAGA
rJMFF010I04+ TTTTTATGTTTATGATTATCAGAATAATATCATTATATCCTTGTAATAAAAGGGGAAAGA
                      ____________________________________________________________
consensus TTTTTATGTTTATGATTATCAGAATAATATCATTATATCCTTGTAATAAAAGGGGAAAGA
 
. : . : . : . : . : . :
rJMFF037P23+ TAGAAGGATAATCTGGAACCAAACAGATGAAGAATGCAGAAATGGAATCGTCCGAACCCA
rJMFF013P09+ TAGAAGGATAATCTGGAACCAAACAGATGAAGAATGCAGAAATGGAATCGTCCGAACCCA
rJMFF016O16+ TAGAAGGATAATCTGGAACCAAACAGATGAAGAATGCAGAAATGGAATCGTCCGAACCCA
rJMFF026L07+ TAGAAGGATAATCTGGAACCAAACAGATGAAGAATGCAGAAATGGAATCGTCCGAACCCA
rJMFF040P14+ TAGAAGGATAATCTGGAACCAAACAGATGAAGAATGCAGAAATGGAATCGTCCGAACCCA
rJMFF032I20+ TAG
rJMFF010I04+ TAGAAGGATAATCTGGAACCAAACAGATGAAGAATGCAGAAATGGAATCGTCCGAACCCA
                      ____________________________________________________________
consensus TAGAAGGATAATCTGGAACCAAACAGATGAAGAATGCAGAAATGGAATCGTCCGAACCCA
 
. : . : . : . : . : . :
rJMFF037P23+ CGTATATGCAACAACACTC-TGGAAGAACTACGGACCAAATT
rJMFF013P09+ CGTATATGCAACAACACTC-TGGAAGAACTACGGACCAAATT
rJMFF016O16+ CGTATATGCAACAACACTCTTGGAAGAACTACGGACCAAATTTCGTCTCGTGACGAGATG
rJMFF026L07+ CGTATATGCAACAACACTCTTGGAAGAACTACGGACCAAATTTCGTCTCGTGACGAGATG
rJMFF040P14+ CGTATATGCAACAACACTCTTGGAAGAACTACGGACCAAATTTCGTCTCGTGACGAGATG
rJMFF010I04+ CGTATATGCAACAACACTCTTGGAAGAACTACGGACCAAATTTCGTCTCGTGACGAGATG
                      ____________________________________________________________
consensus CGTATATGCAACAACACTCTTGGAAGAACTACGGACCAAATTTCGTCTCGTGACGAGATG
 
. : . : . : . : . : . :
rJMFF016O16+ CAATACCCAGTGTAGTAGTGTATTGTTGTCACTTTGTCTTGATTGCTTCACATAAAA
rJMFF026L07+ CAATACCCAGTGTAGTAGTGTATTGTTGTCACTTTGTCTTGATTGCTTCACATAAAA
rJMFF040P14+ CAATACCCAGTGTAGTAGTGTATTGTTGTCACTT
rJMFF010I04+ CAATACCCAGTGTAGTAGTGTATTGTTGTCACTTTGTCTTGATTGCTTCACATAAAAATG
                      ____________________________________________________________
consensus CAATACCCAGTGTAGTAGTGTATTGTTGTCACTTTGTCTTGATTGCTTCACATAAAAATG