Previous Contig 008650:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H16Sequence514014254795008650 (3)gb:ATAC013483_15435494e-10Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen
JMSF004C18Sequence333003593 (14)gb:AF316414_17855383e-20Helianthus annuus resistance gene analog NBS9 (NBS9) gene, partial cds.197008650 (3)
JMSF005I11Sequence352008650 (3)gb:ATAC013483_15435498e-08Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010H16+ AAATGNCAGCTGAGATT
                      ____________________________________________________________
consensus AAATGNCAGCTGAGATT
 
. : . : . : . : . : . :
rJMFF010H16+ TACACACTTGGGTCAGATTCCTGGAGGAGGATAGGGAAAGCTCCCTGCCNTAAGAGAGGG
                      ____________________________________________________________
consensus TACACACTTGGGTCAGATTCCTGGAGGAGGATAGGGAAAGCTCCCTGCCNTAAGAGAGGG
 
. : . : . : . : . : . :
JMSF005I11+ CTGGATCATTGAAACTGCTAAAACC
rJMFF010H16+ GGATCATTTGATCCTTTTATCAATGGTTCTCTGCACTGGATCATTGAAACTGCTAAAACC
                      ____________________________________________________________
consensus GGATCATTTGATCCTTTTATCAATGGTTCTCTGCACTGGATCATTGAAACTGCTAAAACC
 
. : . : . : . : . : . :
JMSF005I11+ TCTGAGCAAATATGTTCATTTGACTTGAACACTGAGCAATTCAGAACTCTACCCTCGCCT
rJMFF010H16+ TCTGAGCAAATATGTTCATTTGACTTGAACACTGAGCAATTCAGAACTCTACCCTCGCCT
                      ____________________________________________________________
consensus TCTGAGCAAATATGTTCATTTGACTTGAACACTGAGCAATTCAGAACTCTACCCTCGCCT
 
. : . : . : . : . : . :
JMSF005I11+ CCTCACTTCAATGCAAACTATATTAAAAAAGTTTCCTGGATAAATATTGGTACCCTTGGA
rJMFF010H16+ CCTCACTTCAATGCAAACTATATTAAAAAAGTTTCCTGGATAAATATTGGTACCCTTGGA
                      ____________________________________________________________
consensus CCTCACTTCAATGCAAACTATATTAAAAAAGTTTCCTGGATAAATATTGGTACCCTTGGA
 
. : . : . : . : . : . :
JMSF005I11+ GGGCATTTCTGTTTGTGCTATATTTATGATGATGCTTGCTTGGAGGTTTGGGTGATGAAA
rJMFF010H16+ GGGCATTTCTG-TTGTGCTATATTTATGATGATGCTTGCTTGGAGGTTTGGGTGATGAAA
                      ____________________________________________________________
consensus GGGCATTTCTGTTTGTGCTATATTTATGATGATGCTTGCTTGGAGGTTTGGGTGATGAAA
 
. : . : . : . : . : . :
JMSF005I11+ GATTATGGAGTGAAGGAGTCCTGGAGTAGAGAATTCAGCATAGACATAAAGTTCTATTGT
rJMFF010H16+ GATTATGGAGTGAAGGAGTCCTGGAGTAGAGAATTCAGCATAGACATAAAGTTCTATTGT
                      ____________________________________________________________
consensus GATTATGGAGTGAAGGAGTCCTGGAGTAGAGAATTCAGCATAGACATAAAGTTCTATTGT
 
. : . : . : . : . : . :
JMSF005I11+ GGTCTGAAAGTGGAAAATCTGCGGCAACCCGTTAAATTCCTGAACAATGGTGATATGTGG
rJMFF010H16+ GGTCTGAAAGTGGAAAATCTGCGGCAACCCGTT-AATTCCTGAACAATGGTGATATGTGG
                      ____________________________________________________________
consensus GGTCTGAAAGTGGAAAATCTGCGGCAACCCGTTAAATTCCTGAACAATGGTGATATGTGG
 
. : . : . : . : . : . :
JMSF005I11+ CTCATGTGCAGTTCTAATTCT
rJMFF010H16+ CTCATGTGCAGTTCTAATTCTCTGGCTTCTTATAACCCAAGGAAGGGAACTTTCAGAGAC
                      ____________________________________________________________
consensus CTCATGTGCAGTTCTAATTCTCTGGCTTCTTATAACCCAAGGAAGGGAACTTTCAGAGAC
 
. : . : . : . : . : . :
rJMFF010H16+ TTCAAAGCCCTGGCAAAGTGGAAGTCTGAAGTTATTGCTCTTGTTCCCAGCTTTGTATCA
                      ____________________________________________________________
consensus TTCAAAGCCCTGGCAAAGTGGAAGTCTGAAGTTATTGCTCTTGTTCCCAGCTTTGTATCA
 
. : . : . : . : . : . :
rJMSF004C18+ CCATGTCAAGCAAAAATCTGAGAGTGGAAAGTTTGAGTCGAAGNATACCG
rJMFF010H16+ CTGAAAGATGCCATGTCAAGCAAAAATCTGAGAGTGGAAAGTTTGAGTCGAAGAATACCG
                      ____________________________________________________________
consensus CTGAAAGATGCCATGTCAAGCAAAAATCTGAGAGTGGAAAGTTTGAGTCGAAGAATACCG
 
. : . : . : . : . : . :
rJMSF004C18+ AAAATTTATCGTTGAAATCTTGCNNGCTTGCTTGCTCGCTGCCTGCATAGAGGAGGTTAG
rJMFF010H16+ AAAATTTATTGTTGAAATCTTGCTTGCTTGCTTGCTTGCTGCCTGCATAGAGGAGGTTAG
                      ____________________________________________________________
consensus AAAATTTATTGTTGAAATCTTGCTTGCTTGCTTGCTTGCTGCCTGCATAGAGGAGGTTAG
 
. : . : . : . : . : . :
rJMSF004C18+ TAGNGGCTNGTATAGCTAAACTGCNTGGGCAANAGAAGTNTGTATTCTCTTAGCATATAT
rJMFF010H16+ TAGAGGCTTGTATAGCTAAACTGCTTGGGCAAAAGAAGTATGTATTCTCTTAGCATATAT
                      ____________________________________________________________
consensus TAGAGGCTTGTATAGCTAAACTGCTTGGGCAAAAGAAGTATGTATTCTCTTAGCATATAT
 
. : . : . : . : . : . :
rJMSF004C18+ GTCTTNATTTATTATTATACTCTCTCA
rJMFF010H16+ GTTTTTATTTATTATTATACTCTCTCAATGAGGTTCTGAGGATTTATATTATATNGACAG
                      ____________________________________________________________
consensus GTTTTTATTTATTATTATACTCTCTCAATGAGGTTCTGAGGATTTATATTATATNGACAG