Previous Contig 008649:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010H15Sequence539003069 (6)gb:BT010150_16402166e-59Arabidopsis thaliana At1g34220 gene, complete cds.664008649 (6)gb:BT010150_16402167e-06Arabidopsis thaliana At1g34220 gene, complete cds.
JMFF011C04Sequence568003069 (6)pir|E86466|E864662e-71protein F23M19.10 [imported] - Arabidopsis thaliana>gb:AE005172_892225 Arabidops763008649 (6)gb:BT010150_16402169e-06Arabidopsis thaliana At1g34220 gene, complete cds.
JMFF020F07Sequence496003069 (6)gb:BT010150_16402164e-48Arabidopsis thaliana At1g34220 gene, complete cds.689008649 (6)sp|P04929|HRPX_PLALO7e-06Histidine-rich glycoprotein precursor.>pir|A22692|KGZQHL histidine-rich glycopro
JMFF022J11Sequence533003069 (6)pir|E86466|E864668e-69protein F23M19.10 [imported] - Arabidopsis thaliana>gb:AE005172_892225 Arabidops759008649 (6)sp|P04929|HRPX_PLALO6e-07Histidine-rich glycoprotein precursor.>pir|A22692|KGZQHL histidine-rich glycopro
JMFF024M07Sequence448003069 (6)gb:BT010150_16402162e-53Arabidopsis thaliana At1g34220 gene, complete cds.695008649 (6)gb:BT010150_16402168e-06Arabidopsis thaliana At1g34220 gene, complete cds.
JMFN018E24Sequence628008649 (6)sp|P04929|HRPX_PLALO9e-08Histidine-rich glycoprotein precursor.>pir|A22692|KGZQHL histidine-rich glycopro

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF011C04+ ATAAGTTAATGGTTTAGCATCAAATAAACCCGGAGATG
rJMFF022J11+ GCATCAAATAAA-CCGGAGATG
                      ____________________________________________________________
consensus ATAAGTTAATGGTTTAGCATCAAATAAACCCGGAGATG
 
. : . : . : . : . : . :
rJMFF024M07+ GGAGCATAAATTGACTGATTTGTCACCTGCTCCA
rJMFF011C04+ GAGCATGAGGAAGTTTTGTTGGAAAGGGAGCATAAATTGACTGATTTGTCACCTGCTCCA
rJMFF022J11+ GAGCATGAGGAAGTTTTGTTGGAAAGGGAGCATAAATTGACTGATTTGTCACCTGCTCCA
rJMFF020F07+ ACCTGCTCCA
                      ____________________________________________________________
consensus GAGCATGAGGAAGTTTTGTTGGAAAGGGAGCATAAATTGACTGATTTGTCACCTGCTCCA
 
. : . : . : . : . : . :
rJMFF024M07+ AATGAAGAGAAGCAGTTCTTGCCATTCAT-GGCTCCCCCACCAAAATCATCTTCTTCTGT
JMFN018E24- TGAAGAGAAGCAGTTCTTGCCATTCATGGGCTCCCCCACCAAAATCATCTTCTTCTGT
rJMFF011C04+ AATGAAGAGAAGCAGTTCTTGCCATTCAT-GGCTCCCCCACCAAAATCATCTTCTTCTGT
rJMFF022J11+ AATGAAGAGAAGCAGTTCTTGCCATTCAT-GGCTCCCCCACCAAAATCATCTTCTTCTGT
rJMFF020F07+ AATGAAGAGAAGCAGTTCTTGCCATTCAT-GGCTCCCCCACCAAAATCATCTTCTTCTGT
rJMFF010H15+ CTGT
                      ____________________________________________________________
consensus AATGAAGAGAAGCAGTTCTTGCCATTCAT-GGCTCCCCCACCAAAATCATCTTCTTCTGT
 
. : . : . : . : . : . :
rJMFF024M07+ GAAACAAAGTGATCTGCCTCCACCCCTTCCAAAAGCCCCAAGTGAAACGAATGTAGATTT
JMFN018E24- GAAACAAAGTGATCTGCCTCCACCCCTTCCAAAAGCCCCAAGTGAAACGAATGTAGATTT
rJMFF011C04+ GAAACAAAGTGATCTGCCTCCACCCCTTCCAAAAGCCCCAAGTGAAACGAATGTAGATTT
rJMFF022J11+ GAAACAAAGTGATCTTCCTCCACCCCTTCCAAAAGCCCCAAGTGAAACGAATGTAGATTT
rJMFF020F07+ GAAACAAAGTGATCTGCCTCCACCCCTTCCAAAAGCCCCAAGTGAAACGAATGTAGATTT
rJMFF010H15+ GAAACAAAGTGATCTGCCTCCACCCCTTCCAAAAGCCCCAAGTGAAACGAATGTAGATTT
                      ____________________________________________________________
consensus GAAACAAAGTGATCTGCCTCCACCCCTTCCAAAAGCCCCAAGTGAAACGAATGTAGATTT
 
. : . : . : . : . : . :
rJMFF024M07+ ACAAGATGTATTAGCCGCTGCTCAGGCCGCGGCTGAATCAGCTGAACGTGCAGCTGCTGC
JMFN018E24- ACAAGATGTATTAGCCGCTGCTCAGGCCGCGGCTGAATCAGCTGAACGTGCAGCTGCTGC
rJMFF011C04+ ACAAGATGTATTAGCCGCTGCTCAGGCCGCGGCTGAATCAGCTGAACGTGCAGCTGCTGC
rJMFF022J11+ ACAAGATGTATTAGCCGCTGCTCAGGCCGCGGCTGAATCAGCTGAACGTGCAGCTGCTGC
rJMFF020F07+ ACAAGATGTATTAGCCGCTGCTCAGGCCGCGGCTGAATCAGCTGAACGTGCAGCTGCTGC
rJMFF010H15+ ACAAGATGTATTAGCCGCTGCTCAGGCCGCGGCTGAATCAGCTGAACGTGCAGCTGCTGC
                      ____________________________________________________________
consensus ACAAGATGTATTAGCCGCTGCTCAGGCCGCGGCTGAATCAGCTGAACGTGCAGCTGCTGC
 
. : . : . : . : . : . :
rJMFF024M07+ TGCTCGCTCAGCGGCGAGCCTTGCACAGCTCAGAATCAGTGAACTAACAAAGAAAAAGGA
JMFN018E24- TGCTCGCTCAGCGGCGAGCCTTGCACAGCTCAGAATCAGTGAACTAACAAAGAAAAAGGA
rJMFF011C04+ TGCTCGCTCAGCGGCGAGCCTTGCACAGCTCAGAATCAGTGAACTAACAAAGAAAAAGGA
rJMFF022J11+ TGCTCGCTCAGCGGCGAGCCTTGCACAGCTCAGAATCAGTGAACTAACAAAGAAAAAGGA
rJMFF020F07+ TGCTCGCTCAGCGGCGAGCCTTGCACAGCTCAGAATCAGTGAACTAACAAAGAAAAAGGA
rJMFF010H15+ TGCTCGCTCAGCGGCGAGCCTTGCACAGCTCAGAATCAGTGAACTAACAAAGAAAAAGGA
                      ____________________________________________________________
consensus TGCTCGCTCAGCGGCGAGCCTTGCACAGCTCAGAATCAGTGAACTAACAAAGAAAAAGGA
 
. : . : . : . : . : . :
rJMFF024M07+ TGATGCCGGCAAGGACCCATTCCATGTTGATGCACAGAAGGATGACAGCTCTGAAAAGCC
JMFN018E24- TGATGCCGGCAAGGACCCATTCCATGTTGATGCACAGAAGGATGACAGCTCTGAAAAGCC
rJMFF011C04+ TGATGCCGGCAAGGACCCATTCCATGTTGATGCACAGAAGGATGACAGCTCTGAAAAGCC
rJMFF022J11+ TGATGCCGGCAAGGACCCATTCCATGTTGATGCACAGAAGGATGACAGCTCTGAAAAGCC
rJMFF020F07+ TGATGCCGGCAAGGACCCATTCCATGTTGATGCACAGAAGGATGACAGCTCTGAAAAGCC
rJMFF010H15+ TGATGCCGGCAAGGACCCATTCCATGTTGATGCACAGAAGGATGACAGCTCTGAAAAGCC
                      ____________________________________________________________
consensus TGATGCCGGCAAGGACCCATTCCATGTTGATGCACAGAAGGATGACAGCTCTGAAAAGCC
 
. : . : . : . : . : . :
rJMFF024M07+ TCATTTGGAGCACGAAAGCTCATTTTCCAGCTCCGATGCTGCTTCAATCTCTGAAAGCCC
JMFN018E24- TCATTTGGAGCACGAAAGCTCATTTTCCAGCTCCGATGCTGCTTCAATCTCTGAAAGCCC
rJMFF011C04+ TCATTTGGAGCACGAAAGCTCATTTTCCAGCTCCGATGCTGCTTCAATCTCTGAAAGCCC
rJMFF022J11+ TCATTTGGAGCACGAAAGCTCATTTTCCAGCTCCGATGCTGCTTCAATCTCTGAAAGCCC
rJMFF020F07+ TCATTTGGAGCACGAAAGCTCATTTTCCAGCTCCGATGCTGCTTCAATCTCTGAAAGCCC
rJMFF010H15+ TCATTTGGAGCACGAAAGCTCATTTTCCAGCTCCGATGCTGCTTCAATCTCTGAAAGCCC
                      ____________________________________________________________
consensus TCATTTGGAGCACGAAAGCTCATTTTCCAGCTCCGATGCTGCTTCAATCTCTGAAAGCCC
 
. : . : . : . : . : . :
rJMFF024M07+ AAAGCTCAACGATCAATCGAGGCATCATCAACCTCAGAGATTGCCTTCTATCGACGATGA
JMFN018E24- AAAGCTCAACGATCAATCGAGGCATCATCAACCTCAGAGATTGCCTTCTATCGACGATGA
rJMFF011C04+ AAAGCTCAACGATCAATCGAGGCATCATCAACCTCAGAGATTGCCTTCTATCGACGATGA
rJMFF022J11+ AAAGCTCAACGATCAATCGAGGCATCATCAACCTCAGAGATTGCCTTCTATCGACGATGA
rJMFF020F07+ AAAGCTCAACGATCAATCGAGGCATCATCAACCTCAGAGATTGCCTTCTATCGACGATGA
rJMFF010H15+ AAAGCTCAACGATCAATCGAGGCATCATCAACCTCAGAGATTGCCTTCTATCGACGATGA
                      ____________________________________________________________
consensus AAAGCTCAACGATCAATCGAGGCATCATCAACCTCAGAGATTGCCTTCTATCGACGATGA
 
. : . : . : . : . : . :
rJMFF024M07+ AACATACTTCTCATACCCAAACTTGTTTACACGACAGGGCTCAAATCTTAGTTCAAATGC
JMFN018E24- AACATACTTCTCATACCCAAACTTGTTTACACGACAGGGCTCAAATCTTAGTTCAAATGC
rJMFF011C04+ AACATACTTCTCATACCCAAACTTGTTTACACGACAGGGCTCAAATCTTAGTTCAAATGC
rJMFF022J11+ AACATACTTCTCATACCCAAACTTGTTTACACGACAGGGCTCAAATCTTAGTTCAAATGC
rJMFF020F07+ AACATACTTCTCATACCCAAACTTGTTTACACGACAGGGCTCAAATCTTAGTTCAAATGC
rJMFF010H15+ AACATACTTCTCATACCCAAACTTGTTTACACGACAGGGCTCAAATCTTAGTTCAAATGC
                      ____________________________________________________________
consensus AACATACTTCTCATACCCAAACTTGTTTACACGACAGGGCTCAAATCTTAGTTCAAATGC
 
. : . : . : . : . : . :
rJMFF024M07+ TCAGTCATTCAACTCCAGGCCACCACATGAGCAGTGAGCTGAATCACTTTGCCCCACCAC
JMFN018E24- TCAGTCATTCAACTCCAGGCCACCACATGAGCAGTGAGCTGAATCACTTTGCCCCACCAC
rJMFF011C04+ TCAGTCATTCAACTCCAGGCCACCACATGAGCAGTGAGCTGAATCACTTTGCCCCACCAC
rJMFF022J11+ TCAGTCATTCAACTCCAGGCCACCACATGAGCAGTGAGCTGAATCACTTTGCCCCACCAC
rJMFF020F07+ TCAGTCATTCAACTCCAGGCCACCACATGAGCAGTGAGCTGAATCACTTTGCCCCACCAC
rJMFF010H15+ TCAGTCATTCAACTCCAGGCCACCACATGAGCAGTGAGCTGAATCACTTTGCCCCACCAC
                      ____________________________________________________________
consensus TCAGTCATTCAACTCCAGGCCACCACATGAGCAGTGAGCTGAATCACTTTGCCCCACCAC
 
. : . : . : . : . : . :
rJMFF024M07+ CACCACCACCAAAGCTGCCGCCTGCTGGGGCTGTCATAAGATCTTCTAGTGTCTACCTTA
JMFN018E24- CACCACCACCAAAGCTGCCGCCTGCTGGGGCTGTCATAAGATCTTCTAGTGTCTACCTTA
rJMFF011C04+ CACCACCACCAAAGCTGCCGCCTGCTGGGGCTGTCATAAGATCTTCTAGTGTCTACCTTA
rJMFF022J11+ CACCACCACCAAAGCTGCCGCCTGCTGGGGCTGTCATAAGATCTTCTAGTGTCTACCTTA
rJMFF020F07+ CACCACCACCAAAGCTGCCGCCTGCTGGGGCTGTCATAAGATCTTCTAGTGTCTACCTTA
rJMFF010H15+ CACCACCACCAAAGCTGCCGCCTGCTGGGGCTGTCATAAGATCTTCTAGTGTCTACCTTA
                      ____________________________________________________________
consensus CACCACCACCAAAGCTGCCGCCTGCTGGGGCTGTCATAAGATCTTCTAGTGTCTACCTTA
 
. : . : . : . : . : . :
rJMFF024M07+ TATTTGCCTACAAGTACTACTTATTTTGATTTGTATCAGAGAAAATGCAAGGGTAATCAA
JMFN018E24- TATTTGCCCTACAGTACTACTTATTTTGAT
rJMFF011C04+ TATTTGCCTACAAGTACTACTTATTTTGATTTGTATCAGAGAAAATGCAAGGGTAATCAA
rJMFF022J11+ TATTTGCCTACAAGTACTACTTATTTTGATTTGTATCAGAGAAAATGCAAGGGTAATCAA
rJMFF020F07+ TATTTGCCTACAAGTACTACTTATTTTGATTTGTATCAGAGAAAATGCAAGGGTAATCAA
rJMFF010H15+ TATTTGCCTACAAGTACTACTTATTTTGATTTGTATCAGAGAAAATGCAAGGGTAATCAA
                      ____________________________________________________________
consensus TATTTGCCTACAAGTACTACTTATTTTGATTTGTATCAGAGAAAATGCAAGGGTAATCAA
 
. : . : . : . : . : . :
rJMFF024M07+ TG
rJMFF011C04+ TGTAAT
rJMFF022J11+ TGTAATTTGAGTTTCTCAG
rJMFF020F07+ TGTAATTTGAGTTTCTCAG
rJMFF010H15+ TGTAATTTGAGTTTCTCAGTTGAACTGTGGTTTTGTAAAGATGCTTTTTTGACAATTAGT
                      ____________________________________________________________
consensus TGTAATTTGAGTTTCTCAGTTGAACTGTGGTTTTGTAAAGATGCTTTTTTGACAATTAGT