Previous Contig 008645:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009M12Sequence552004761 (5)gb:LES011418_16844566e-62Lycopersicon esculentum mRNA for ubiquitin activating enzyme.698008645 (8)gb:LES011418_16844563e-46Lycopersicon esculentum mRNA for ubiquitin activating enzyme.
JMFF010F21Sequence534004761 (5)gb:LES011418_16844561e-55Lycopersicon esculentum mRNA for ubiquitin activating enzyme.777008645 (8)gb:AY072375_15671922e-49Arabidopsis thaliana ubiquitin activating enzyme - like protein (At4g24940) mRNA
JMFF042J22Sequence672008645 (8)gb:LES011418_16844562e-69Lycopersicon esculentum mRNA for ubiquitin activating enzyme.589008645 (8)gb:AY072375_15671922e-32Arabidopsis thaliana ubiquitin activating enzyme - like protein (At4g24940) mRNA
JMSF005O21Sequence265004761 (5)gb:LES011418_16844569e-15Lycopersicon esculentum mRNA for ubiquitin activating enzyme.449008645 (8)gb:AY072375_15671922e-19Arabidopsis thaliana ubiquitin activating enzyme - like protein (At4g24940) mRNA
JMSF006A11Sequence236013060 (9)132008645 (8)
JMSF034G10Sequence653006944 (3)gb:LES011418_16844562e-14Lycopersicon esculentum mRNA for ubiquitin activating enzyme.752008645 (8)gb:LES011418_16844569e-64Lycopersicon esculentum mRNA for ubiquitin activating enzyme.
JMSF034H07Sequence708006944 (3)gb:LES011418_16844562e-14Lycopersicon esculentum mRNA for ubiquitin activating enzyme.747008645 (8)gb:AY072375_15671922e-63Arabidopsis thaliana ubiquitin activating enzyme - like protein (At4g24940) mRNA

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042J22- CTGTCGACTTGTCGAGCAAGGAGCCTAAGGAAGAAGACGGTTCGCACTACCCTCAACTC
                      ____________________________________________________________
consensus CTGTCGACTTGTCGAGCAAGGAGCCTAAGGAAGAAGACGGTTCGCACTACCCTCAACTC
 
. : . : . : . : . : . :
JMFF042J22- TTGATTCTTACAGCTGTTTTGTTCGGGAATATGGAGCGAGCGGAGTTGACAGAGCAGGAA
                      ____________________________________________________________
consensus TTGATTCTTACAGCTGTTTTGTTCGGGAATATGGAGCGAGCGGAGTTGACAGAGCAGGAA
 
. : . : . : . : . : . :
JMFF042J22- ACTGCCATCTACGATCGTCAGATTAGGGTCTGGGGCGTTGATGCTCAAAGACGCCTCAGT
                      ____________________________________________________________
consensus ACTGCCATCTACGATCGTCAGATTAGGGTCTGGGGCGTTGATGCTCAAAGACGCCTCAGT
 
. : . : . : . : . : . :
JMFF042J22- AAAGCTCATGTGTTTGTCAGTGGACTCAAAGGGACTGCTGTAGAGATGAAAATGTTTTCG
                      ____________________________________________________________
consensus AAAGCTCATGTGTTTGTCAGTGGACTCAAAGGGACTGCTGTAGAGATGAAAATGTTTTCG
 
. : . : . : . : . : . :
JMFF042J22- GTGGGAAATCTGTTGCCGAGCTCTGTTGTGATTCTTTGAAAGAATTCAACCCTATGGTTT
                      ____________________________________________________________
consensus GTGGGAAATCTGTTGCCGAGCTCTGTTGTGATTCTTTGAAAGAATTCAACCCTATGGTTT
 
. : . : . : . : . : . :
JMFF042J22- ATGTTTCTGTCCAAAAAGGTGATTTGTCAAGTTTTGATGCTGATTTCTTTGATAAGTTTG
                      ____________________________________________________________
consensus ATGTTTCTGTCCAAAAAGGTGATTTGTCAAGTTTTGATGCTGATTTCTTTGATAAGTTTG
 
. : . : . : . : . : . :
JMFF042J22- ACGCTGTTGTTATCAGCCACTGCTCTCTTTCAACAAAGAAATCTGTAAATGCAAAGTGTC
rJMSF034H07+ AATCTGTAAATGCCAAGTGTC
rJMSF034G10+ AAGAAATCTGTAAATGCAAAGTGTC
                      ____________________________________________________________
consensus ACGCTGTTGTTATCAGCCACTGCTCTCTTTCAACAAAGAAATCTGTAAATGCAAAGTGTC
 
. : . : . : . : . : . :
JMFF042J22- GAAAGTTGTCAAAGCGCATTGCTTTTTATGCCGTGGATGTTAGAGATTCTTGTGGTGAGA
rJMSF034H07+ GAAAGTTGTCCAAGCGCATTGCTTTTTATGCCGTGGATGTTAGAGATTCTTGTGGTGAGA
rJMSF034G10+ GAAAGNTGTCAAAGCGCATTGCTTTTTATGCCGTGGATGTTAGAGATTCTTGTGGTGAGA
                      ____________________________________________________________
consensus GAAAGTTGTCAAAGCGCATTGCTTTTTATGCCGTGGATGTTAGAGATTCTTGTGGTGAGA
 
. : . : . : . : . : . :
JMFF042J22- TTTTCATTGATTTGCAGAGCTACACCTATTCTAAGAAAAAATCTGAAGAAATGAGTGATT
rJMSF034H07+ TTTTCATTGATTTGCAGAGCTACACCTATTCTAAGAAAAAATCTGAAGAAATGAGTGATT
rJMSF034G10+ TTTTCATTGATTTGCAGAGCTACACCTATTCTAAGAAAAAATCTGAAGAAATGAGTGATT
rJMFF009M12+ AAGAAAAAATCTGAAGAAATGAGTGATT
rJMFF010F21+ TCATTGATTTGCAGAGCTACACCTATTCTAAGAAAAAATCTGAAGAAATGAGTGATT
                      ____________________________________________________________
consensus TTTTCATTGATTTGCAGAGCTACACCTATTCTAAGAAAAAATCTGAAGAAATGAGTGATT
 
. : . : . : . : . : . :
JMFF042J22- GCCAACTGAACTATCCAAGTTTTGAGGAAGCTATTGCAGTCCCATGGAGAGGTTTACCTA
rJMSF034H07+ GCCAACTGAACTATCCAAGTTTTGAGGAAGCTATTGCAGTCCCATGGAGAGGTTTACCTA
rJMSF034G10+ GCCAACTGAACTATCCAAGTTTTGAGGAAGCTATTGCAGTCCCATGGAGAGGTTTACCTA
rJMFF009M12+ GCCAACTGAACTATCCAAGTTTTGAGGAAGCTATTGCAGTCCCATGGAGAGGTTTACCTA
rJMFF042J22+ A
rJMFF010F21+ GCCAACTGAACTATCCAAGTTTTGAGGAAGCTATTGCAGTCCCATGGAGAGGTTTACCTA
                      ____________________________________________________________
consensus GCCAACTGAACTATCCAAGTTTTGAGGAAGCTATTGCAGTCCCATGGAGAGGTTTACCTA
 
. : . : . : . : . : . :
JMFF042J22- AGAGAATGGNCAAGCTATTCTTTGCTATGAGAGTCATAGAAAGGTTTGAAGAGTTTGAAG
rJMSF034H07+ AGAGAATGGCAAAGCTATTCTTTGCTATGAGAGTCATAGAAAGGTTTGAAGAGTTTGAAG
rJMSF034G10+ AGAGAATGGCAAAGCTATTCTTTGCTATGAGAGTCATAGAAAGGTTTGAAGAGTTTGAAG
rJMFF009M12+ AGAGAATGGCAAAGCTATTCTTTGCTATGAGAGTCATAGAAAGGTTTGAAGAGTTTGAAG
rJMFF042J22+ AGAGAATGGCAAAGCTATTCTTTGCTATGAGAGTCATAGAAAGGTTTGAAGAGTTTGAAG
rJMFF010F21+ AGAGAATGGCAAAGCTATTCTTTGCTATGAGAGTCATAGAAAGGTTTGAAGAGTTTGAAG
                      ____________________________________________________________
consensus AGAGAATGGCAAAGCTATTCTTTGCTATGAGAGTCATAGAAAGGTTTGAAGAGTTTGAAG
 
. : . : . : . : . : . :
JMFF042J22- GGGGCGAACCTGA
rJMSF034H07+ GGGGCGAACCTGAAACAGCATCTAATGATGCTGACCTCCTAAATGTTCAAAAATTGAGGA
rJMSF034G10+ GGGGCGAACCTGAAACAGCATCTAATGATGCTGACCTCCTAAATGTTCAAAAATTGAGGA
rJMFF009M12+ GGGGCGAACCTGAAACAGCATCTAATGATGCTGACCTCCTAAATGTTCAAAAATTGAGGA
rJMFF042J22+ GGGGCGAACCTGAAACAGCATCTAATGATGCTGACCTCCTAAATGTTCAAAAATTGAGGA
rJMFF010F21+ GGGGCGAACCTGAAACAGCATCTAATGATGCTGACCTCCTAAATGTTCAAAAATTGAGGA
                      ____________________________________________________________
consensus GGGGCGAACCTGAAACAGCATCTAATGATGCTGACCTCCTAAATGTTCAAAAATTGAGGA
 
. : . : . : . : . : . :
rJMSF034H07+ AGGAACTCTGTGAGGCTCAGGGCTTGAGTGAATCTCAAATTCCTGATTCCCTCTTGAAAC
rJMSF034G10+ AGGAACTCTGTGAGGCTCAGGGCTTGAGTGAATCTCAAATTCCTGATTCCCTCTTGAAAC
rJMFF009M12+ AGGAACTCTGTGAGGCTCAGGGCTTGAGTGAATCTCAAATTCCTGATTCCCTCTTGAAAC
rJMFF042J22+ AGGAACTCTGTGAGGCTCAGGGCTTGAGTGAATCTCAAATTCCTGATTCCCTCTTGAAAC
rJMFF010F21+ AGGAACTCTGTGAGGCTCAGGGCTTGAGTGAATCTCAAATTCCTGATTCCCTCTTGAAAC
                      ____________________________________________________________
consensus AGGAACTCTGTGAGGCTCAGGGCTTGAGTGAATCTCAAATTCCTGATTCCCTCTTGAAAC
 
. : . : . : . : . : . :
rJMSF034H07+ GATTGTTAAGAGGTACAAGAGAGTTTCCTCCAGTTTGTGCCATCATCGGAGGAATTCTTG
rJMSF034G10+ GATTGTTAAGAGGTACAAGAGAGTTTCCTCCAGTTTGTGCCATCATCGGAGGAATTCTTG
rJMFF009M12+ GATTGTTAAGAGGTACAAGAGAGTTTCCTCCAGTTTGTTCCATCATCGGAGGAATTCTTG
rJMFF042J22+ GATTGTTAAGAGGTACAAGAGAGTTTCCTCCAGTTTGTGCCATCATCGGAGGAATTCTTG
rJMSF005O21+ ATTGTTAAGAGGTACAAGAGAGTTTCCTCCAGTTTGTGCCATCATCGGAGGAATTCTTG
rJMFF010F21+ GATTGTTAAGAGGTACAAGAGAGTTTCCTCCAGTTTGTGCCATCATCGGAGGAATTCTTG
                      ____________________________________________________________
consensus GATTGTTAAGAGGTACAAGAGAGTTTCCTCCAGTTTGTGCCATCATCGGAGGAATTCTTG
 
. : . : . : . : . : . :
rJMSF034H07+ GACAGGAGGTGATTAAAGCAATATCTGGCAAAGGTGATCCAATTAAGAATTTCTTCTTTT
rJMSF034G10+ GACAGGAGGTGATTAAAGCAATATCTGGCAAAGGTGATCCAATTAAGAATTTCTTCTTTT
rJMFF009M12+ GACAGGAGGTGATTAAAGCAATATCTGGCAAAGGTGATCCAATTAAGAATTTCTTCTTTT
rJMFF042J22+ GACAGGAGGTGATTAAAGCAATATCTGGCAAAGGTGATCCAATTAAGAATTTCTTCTTTT
rJMSF005O21+ GACAGGAGGTGATTAAAGCAATATCTGGCAAAGGTGATCCAATTAAGAATTTCTTCTTTT
rJMFF010F21+ GACAGGAGGTGATTAAAGCAATATCTGGCAAAGGTGATCCAATTAAGAATTTCTTCTTTT
                      ____________________________________________________________
consensus GACAGGAGGTGATTAAAGCAATATCTGGCAAAGGTGATCCAATTAAGAATTTCTTCTTTT
 
. : . : . : . : . : . :
rJMSF034H07+ ACGACGCCATGGATGGCAAAGGCATAATAGAAGATGTATCTGACATCAAGACTGAATGCT
rJMSF034G10+ ACGACGCCATGGATGGCAAAGGCATAATAGAAGATGTATCTGACATCAAGACTGAATGCT
rJMFF009M12+ ACGACGCCATGGATGGCAAAGGCATAATAGAAGATGTATCTGACATCAAGACTGAATGCT
rJMFF042J22+ ACGACGCCATGGATGGCAAAGGCATAATAGAAGATGTATCTGACATCAAGACTGAATGCT
rJMSF005O21+ ACGACGCCATGGATGGCAAAGGCATAATAGAAGATGTATCTGACATCAAGACTGAATGCT
rJMFF010F21+ ACGACGCCATGGATGGCAAAGGCATAATAGAAGATGTATCTGACATCAAGACTGAATGCT
                      ____________________________________________________________
consensus ACGACGCCATGGATGGCAAAGGCATAATAGAAGATGTATCTGACATCAAGACTGAATGCT
 
. : . : . : . : . : . :
rJMSF034H07+ TGCCGGCTAAGAGAACAGCTGAGGTTCTCTAGGCATAGGTATTCTGTAACCTAACTAAAT
rJMSF034G10+ TGCCGGCTAAGAGAACAGCTGAGGTTCTCTAGGCATAGGTATTCTGTAACCTAACTAAAT
rJMSF006A11+ GAACAGCTGAGGTTCTCTNGGCATAGGTATTCCNTAACCTAACTAAAT
rJMFF009M12+ TGCCGGCTAAGAGAACAGCTGAGGTTCTCTAGGCATAGGTATTCTGTAACCTAACTAAAT
rJMFF042J22+ TGCCGGCTAAGAGAACAGCTGAGGTTCTCTAGGCATAGGTATTCTGTAACCTAACTAAAT
rJMSF005O21+ TGCCGGCTAAGAGAACAGCTGAGGTTCTCTAGGCATAGGTATTCTGTAACCTAACTAAAT
rJMFF010F21+ TGCCGGCTAAGAGAACAGCTGAGGTTCTCTAGGCATAGGTATTCTGTAACCTAACTAAAT
                      ____________________________________________________________
consensus TGCCGGCTAAGAGAACAGCTGAGGTTCTCTAGGCATAGGTATTCTGTAACCTAACTAAAT
 
. : . : . : . : . : . :
rJMSF034H07+ ATTGTATCAGAAAGTTTTTGTAAGTTACACCTTAGAAGAGATTACAGCCATGCTGATTGC
rJMSF034G10+ ATTGTATCAGAAAGTTTTTGTAAGTTACACCTTAGAAGAGATTACAGCCATGCTGATTGC
rJMSF006A11+ ATTGTATCAGAAAGTTTTTGTAAGTTACCCCTTAGNAGAGATNNCAGCCATNCTGATTGC
rJMFF009M12+ ATTGTATCAGAAAGTTTTTGTAAGTTACACCTTAGAAGAGATTACAGCCATGCTGATTGC
rJMFF042J22+ ATTGTATCAGAAAGTTTTTGTAAGTTACACCTTAGAAGAGATTACAGCCATGCTGATTGC
rJMSF005O21+ ATTGTATCAGAAAGTTTTTGTAAGTTACACCTTAGAAGAGATTACAGCCATGCTGATTGC
rJMFF010F21+ ATTGTATCAGAAAGTTTTTGTAAGTTACACCTTAGAAGAGATTACAGCCATGCTGATTGC
                      ____________________________________________________________
consensus ATTGTATCAGAAAGTTTTTGTAAGTTACACCTTAGAAGAGATTACAGCCATGCTGATTGC
 
. : . : . : . : . : . :
rJMSF034H07+ TGATTCACTAGTTACGCGTTTTTGTACCTTGTGGTTAAAGGTAGAAGAACCAAACTATTT
rJMSF034G10+ TGATTCACTAGTTACGCGTTTTTGTACCTTGTGGTTAAAGGTAGAAGAACCAAACTATTT
rJMSF006A11+ NGATTCNCTAGTTACGCGTTTT
rJMFF009M12+ TGATTCACTAGTTACGCGTTTTTGTACCTTGTGGTTAAAGGTAGAAGAACCAAACTATTT
rJMFF042J22+ TGATTCACTAGTTACGCGTTTTTGTACCTTGTGGTTAAAGGTAGAAGAACCAAACTATTT
rJMSF005O21+ TGATTCACTAGTTACGCGTTTTTGTACCTTGTGGTTAAAGGTAGAAGAACCAAACTATTT
rJMFF010F21+ TGATTCACTAGTTACGCGTTTTTGTACCTTGTGGTTAAAGGTAGAAGAACCAAACTATTT
                      ____________________________________________________________
consensus TGATTCACTAGTTACGCGTTTTTGTACCTTGTGGTTAAAGGTAGAAGAACCAAACTATTT
 
. : . : . : . : . : . :
rJMSF034H07+ GAGGTT
rJMSF034G10+ GAGGTT
rJMFF009M12+ GAGGTTGTGTTTTTAGATACTTAACAAAAGAAGGCACAGTTGATTCCTCTTCTGAATATT
rJMFF042J22+ GAGGTTGTGTTTTTAGATACTTAACAAAAGAAGGCACAGTTGATTCCT
rJMSF005O21+ GAGGTTGTGTTTTTAGATACTTAACAAAAGAAGGCACAGTTGATTCCTCTTCTGAATATT
rJMFF010F21+ GAGGTTGTGTTTTTAGATACTTAACAAAAGAAGGCACAGTTGATTCCTCTTCTGAATATT
                      ____________________________________________________________
consensus GAGGTTGTGTTTTTAGATACTTAACAAAAGAAGGCACAGTTGATTCCTCTTCTGAATATT
 
. : . : . : . : . : . :
rJMFF009M12+ GCCAAGTTCT
rJMSF005O21+ GCCAAGTTCTGTGACA-TTTCAACTGCTT
rJMFF010F21+ GCCAAGTTCTGTGACATTTTCAACTGCTTTCTTGGGGAAACTTGGCAAGGAATTAACGAA
                      ____________________________________________________________
consensus GCCAAGTTCTGTGACATTTTCAACTGCTTTCTTGGGGAAACTTGGCAAGGAATTAACGAA