Previous Contig 008640:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010C18Sequence247014247758008640 (5)gb:AP003989_18359969e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFN037A19Sequence603008640 (5)gb:AP003989_18359961e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFN040J12Sequence479008640 (5)gb:AP003989_18359962e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFN040J14Sequence421008640 (5)gb:AP003989_18359963e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMSF043E03Sequence774008640 (5)gb:AP003989_18359962e-58Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10552013469 (2)pir|F86301|F863015e-32F19K19.6 protein - Arabidopsis thaliana>gb:AE005172_890642 Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN040J14+ TCATTTTATCGCATCAGGTGAGTGT
JMFN040J12+ TTCTCTACCCTTTCTGGGGTATAAATCATTTTATTGCATCCTGTGAGTGT
JMSF043E03+ TTTTTTTTTTCTCTACCCTTTCTGGGGTATAAATCATTTTATTGCATCCTGTGAGTGT
rJMFF010C18- CCTTTCTGGGGTATAAATCATTTTATTGCATCCTGTGAGTGT
                      ____________________________________________________________
consensus TTTTTTTTTTCTCTACCCTTTCTGGGGTATAAATCATTTTATTGCATCCTGTGAGTGT
 
. : . : . : . : . : . :
JMFN040J14+ AAGCCACAAGGAAAATGTCAAGCAGGTGGCGTGGGTACTCAGATGTCCATGCTACAAATT
JMFN040J12+ AAACCACAAGGAAAATGTCAAGCAGGTGACCTAGGTACTCAGATCTCCATGCTACAAATT
JMSF043E03+ AAACCACAAGGAAAATGTCAAGCAGGTGACCTAGGTACTCTGATCTCCATGCTACAAATT
rJMFF010C18- AAACCACAAGGAAAATGTCAAGCAGGTGACCTAGGTACTCAGATCTCCATGCTACAAATT
                      ____________________________________________________________
consensus AAACCACAAGGAAAATGTCAAGCAGGTGACCTAGGTACTCAGATCTCCATGCTACAAATT
 
. : . : . : . : . : . :
JMFN037A19+ AGTAACAACCAGCACAAGGAATTA
JMFN040J14+ GTCATTCAGTTGGCAATACATATAGATATAGTACCAAGTATCATCCAGCTCAAGGAATTA
JMFN040J12+ TTCAGTTTGCTGGCAAAACATATAGATATAGTAACAAGTAACAACCAGCACAAGGAATTA
JMSF043E03+ TTCAGTTTGCTGGCAAAACATATAGATAT-------AGTAACAACCAGCACAAGGAATTA
rJMFF010C18- TTCAGTTTGCTGGCAAAACATATAGATATAGTAACAAGTAACAACCAGCACAAGGAATTA
                      ____________________________________________________________
consensus TTCAGTTTGCTGGCAAAACATATAGATATAGTAACAAGTAACAACCAGCACAAGGAATTA
 
. : . : . : . : . : . :
JMFN037A19+ TTACTCAAAAATGAATTTAAATAAATGCAGGTGCAGATGAGTAGAGTCTAAACTCTAAAA
JMFN040J14+ CTACTCAAAAATGAATTGAAATAAATCCAGGTGCAGATGAGTAGAGTATAAGCTATTAAG
JMFN040J12+ TTACTCAAAAATGAATTTAAATAAATGCAGGTGCAGATGAGTAGAGTCTAAACTCTAAAA
JMSF043E03+ TTACTCAAAAATGAATTTAAATAAATGCAGGTGCAGATGAGTAGAGTCTAAACTCTAAAA
rJMFF010C18- TTACTCAAAAATGAATTTAAATAAATGCAGGTGCAGATGAGTAGAGTCTAAACTCTAAAA
                      ____________________________________________________________
consensus TTACTCAAAAATGAATTTAAATAAATGCAGGTGCAGATGAGTAGAGTCTAAACTCTAAAA
 
. : . : . : . : . : . :
JMFN037A19+ GGGCAGTTT-AGAAA-CAAGAATCATCAAGTTCAACGTCGTCCAGATGCCACAGATTCGG
JMFN040J14+ GGGGGGTTTGAGAAATCAAGAATCATCAAGTTCAGCGTTGTCCAGAAGCCACAGATCCGG
JMFN040J12+ GGGCGGTTT-AGAAA-CAAGAATCATCAAGTTCAGCGTCGTCCAGATGCCACAGATTCGG
JMSF043E03+ GGGCAGTTT-AGAAA-CAAGAATCATCAAGTTCAACGTCGTCCAGATGCCACAGATTCGG
rJMFF010C18- GGGCGGTTT-AGAAA-CAAGAATCATCAAGTTCAGCGTCGTCCAGATGCCACAGATTCGG
                      ____________________________________________________________
consensus GGGCGGTTT-AGAAA-CAAGAATCATCAAGTTCAGCGTCGTCCAGATGCCACAGATTCGG
 
. : . : . : . : . : . :
JMFN037A19+ TAGAGAAGAGGTACTTCACTCGTGAAAGAATAGAATCCTGTGCAGGATCGTAG-GGATGG
JMFN040J14+ TAGAGAAGAGGTACTTCCATGGGGAAAGAAAGGAATCCAGGGCAGGATAGTAGTGGATGG
JMFN040J12+ TAGAGAAGAGGTACTTCACTCGTGAAAGAATGGAATCCTGTGCAGGATCGTAG-GGATGG
JMSF043E03+ TAGAGAAGAGGTACTTCACTCGTGAAAGAATAGAATCCTGTGCAGGATCGTAG-GGATGG
rJMFF010C18- TAGAGAAGAGGTACTTCACTCGTGAAAGAATGGAATCCTGTGCAGGATCGTAG-GGATGG
                      ____________________________________________________________
consensus TAGAGAAGAGGTACTTCACTCGTGAAAGAATGGAATCCTGTGCAGGATCGTAG-GGATGG
 
. : . : . : . : . : . :
JMFN037A19+ TC-CTTTGAAGGAATCTCCAGGATGGCTGGTATCGGCGTGTTATAACCATCAACCAAAAA
JMFN040J14+ TCTCTGGGGTTGAATGTCCAGGATGGCGGGTATCGGCGCGTTATATCCATCAGCCAAAAT
JMFN040J12+ TC-CTTTGAAGGAATCTCCAGGATGGCTGGTATCGGCGTGTTATAACCATCAACCAAAAA
JMSF043E03+ TC-CTTTGAAGGAATCTCCAGGATGGCTGGTATCGGCGTGTTATAACCATCAACCAAAAA
rJMFF010C18- TC-CTTTGAAGGAATCTCCAGGATGGCTGGTATCGGCGTGTTATAACCATCAACCAAAAA
                      ____________________________________________________________
consensus TC-CTTTGAAGGAATCTCCAGGATGGCTGGTATCGGCGTGTTATAACCATCAACCAAAAA
 
. : . : . : . : . : . :
JMFN037A19+ CCTTATCATGTTCGCAACATATTGGCTGATCAACACTATTGCAATGTCCTCTCTCGTAGT
JMFN040J14+ CCTTATCATATTTGCAACATATTGGCGGATCA
JMFN040J12+ CCTTATCATGTTTGCAACATATTGGCTGATCAACACTATTGCAATGTCCTCTCTTGTAGT
JMSF043E03+ CCTTATCATGTTCGCAACATATTGGCTGATCAACACTATTGCAATGTCCTCTCTCGTAGT
rJMFF010C18- CCTTATCATGTTTGCAACATATTGGCTGATCAACACTATTGCAATGTCCTCTCTTGTAGT
                      ____________________________________________________________
consensus CCTTATCATGTTTGCAACATATTGGCTGATCAACACTATTGCAATGTCCTCTCTTGTAGT
 
. : . : . : . : . : . :
JMFN037A19+ GAACTCTTTAAAAGCATCTTCAATCTGTTTCACCGTAGTTTTTGAATCCACAATAAGGTA
JMFN040J12+ GAACTCTTTAAAA
JMSF043E03+ GAACTCTTTAAAAGCATCTTCAATCTGTTTCACCGTAGTTTTTGAATCCACAATAAGGTA
rJMFF010C18- GAACTCTTTAAAAGCATCTTCAATCTGTTTCACCGTAGTTTTTGAATCCACAATAAGGTA
                      ____________________________________________________________
consensus GAACTCTTTAAAAGCATCTTCAATCTGTTTCACCGTAGTTTTTGAATCCACAATAAGGTA
 
. : . : . : . : . : . :
JMFN037A19+ GTTTGTTTTTCTCCTCAAGTCCACGTTGCCAACTCCAGCCATTAAAAATCCAGTAACCGT
JMSF043E03+ GTTTGTTTTTCTCCTCAAGTCCACGTTGCCAACTCCAGCCATTAAAAATCCAGTAACCGT
rJMFF010C18- GTTTGTTTTTCTCCTCAAGTCCACATTGCCAACTCCAGCCATTAAAAATCCAGTGATTGT
                      ____________________________________________________________
consensus GTTTGTTTTTCTCCTCAAGTCCACGTTGCCAACTCCAGCCATTAAAAATCCAGTAACCGT
 
. : . : . : . : . : . :
JMFN037A19+ ATCCTCATCACCAATCATAGCAATGAGTGCTGAGTTGTTAGTGCGGATCTGAGGTCGGTT
JMSF043E03+ ATCCTCATCACCAATCATAGCAATGAGTGCTGAGTTGTTAGTGCGGATCTGAGGTCGGTT
rJMFF010C18- ATCCTCATCACCAATCATAGCAATGAGTGCCGAGTTGCTGGTGCGGATCTGANGTCGGTT
                      ____________________________________________________________
consensus ATCCTCATCACCAATCATAGCAATGAGTGCTGAGTTGTTAGTGCGGATCTGAGGTCGGTT
 
. : . : . : . : . : . :
JMFN037A19+ TGCCATCCT
JMSF043E03+ TGCCATCCT
rJMFF010C18- TGCCATCCTAAACAAATTTGCTTATGCAGCTGAAAATTCACCGTTAAACAGACACCTTGT
                      ____________________________________________________________
consensus TGCCATCCTAAACAAATTTGCTTATGCAGCTGAAAATTCACCGTTAAACAGACACCTTGT
 
. : . : . : . : . : . :
rJMFF010C18- TCCTGGTGGTGTTTGGACTTCAATTGGTGTAAATCAGTAAATCCAGCGAAAACTCTGCAG
                      ____________________________________________________________
consensus TCCTGGTGGTGTTTGGACTTCAATTGGTGTAAATCAGTAAATCCAGCGAAAACTCTGCAG