Previous Contig 008628:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010A05Sequence541007979 (9)pir|T00696|T006961e-49probable methylenetetrahydrofolate reductase [imported] - Arabidopsis thaliana722008628 (6)gb:AF370515_17923001e-67Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6
JMFF010E12Sequence735008628 (6)gb:AF370515_17923001e-70Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6
JMFF036C04Sequence487007979 (9)pir|T00696|T006966e-54probable methylenetetrahydrofolate reductase [imported] - Arabidopsis thaliana769008628 (6)gb:AF370515_17923005e-76Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6
JMSF040N21Sequence644007979 (9)sp|O80585|MTHR_ARATH4e-81Methylenetetrahydrofolate reductase (EC 1.5.1.20) (MTHFR2).>gb:AC004005_1531327 858008628 (6)gb:AF370515_17923001e-83Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6
JMSF048E15Sequence700007979 (9)sp|O80585|MTHR_ARATH2e-80Methylenetetrahydrofolate reductase (EC 1.5.1.20) (MTHFR2).>gb:AC004005_1531327 782008628 (6)gb:AF174486_17744793e-80Zea mays methylenetetrahydrofolate reductase mRNA, complete cds.
JMSF050D05Sequence301007979 (9)gb:AF370515_17923000.005Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6754008628 (6)gb:AF370515_17923003e-72Arabidopsis thaliana putative methylenetetrahydrofolate reductase (At2g44160; F6

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040N21+ GGAGCCCNTTCTGACCCATCAGTTCATGCGGCCA
                      ____________________________________________________________
consensus GGAGCCCNTTCTGACCCATCAGTTCATGCGGCCA
 
. : . : . : . : . : . :
rJMSF048E15+ AGAGTGGGCTGTTCCNTTGAATAGCTTTGAAGA
rJMSF050D05+ TGAATAGCTTNGAAGA
rJMSF040N21+ CGTGCCACGGGATAAGAAACTTCAAGAAGAGTGGGCTGTTCCTTTGAATAGCTTTGAAGA
rJMFF036C04+ GAAGA
                      ____________________________________________________________
consensus CGTGCCACGGGATAAGAAACTTCAAGAAGAGTGGGCTGTTCCTTTGAATAGCTTTGAAGA
 
. : . : . : . : . : . :
rJMSF048E15+ TATTGGTGAGATATTTTCCAAGTACTGTCTTGGAGAACTCAGAAGTAA-CCCTTGGTCTG
rJMSF050D05+ TANTGGTGAGATATTTTCCAAGTACTGTCT-GGAGAACTCAGAAGTAA-CCCTTGGTCTG
rJMSF040N21+ TATTGGTGAGATATTTTCCAAGTACTGTCTTGGAGAACTCAGAAGTAA-CCCTTGGTCTG
rJMFF036C04+ TATTGGTGAGATATTTCCCAAGTACTGTCTNGGAGAACTCAGAAGTAA-CCCTTGGTCTG
rJMFF010E12+ GAACTCAGAAGTAACCCCTTGGTCTG
rJMFF010A05+ CTG
                      ____________________________________________________________
consensus TATTGGTGAGATATTTTCCAAGTACTGTCTTGGAGAACTCAGAAGTAA-CCCTTGGTCTG
 
. : . : . : . : . : . :
rJMSF048E15+ AAATAGATGGGCTTCAACCAGAGACAAAAACCATCAACGAACAGTTGGGTGTTATTAACA
rJMSF050D05+ AAATAGATGGGCTTCAACCAGAGACAAAAACCATCAACGAACAGTTGGGTGTTATTAACA
rJMSF040N21+ AAATAGATGGGCTTCAACCAGAGACAAAAACCATCAACGAACAGTTGGGTGTTATTAACA
rJMFF036C04+ AAATAGATGGGCTTCAACCAGAGACAAAAACCATCAACGAACAGTTGGGTGTTATTAACA
rJMFF010E12+ AAATAGATGGGCTTCAACCAGAGACAAAAACCATCAACGAACAGTTGGGTGTTATTAACA
rJMFF010A05+ AAATAGATGGGCTTCAACCAGAGACAAAAACCATCAACGAACAGTTGGGTGTTATTAACA
                      ____________________________________________________________
consensus AAATAGATGGGCTTCAACCAGAGACAAAAACCATCAACGAACAGTTGGGTGTTATTAACA
 
. : . : . : . : . : . :
rJMSF048E15+ AAAAAGGGTTCCTTACAATCAACAGCCAACCAGCAGTTAATGGAGAAAAATCTGGCTCAC
rJMSF050D05+ AAAAAGGGTTCCTTACAATCAACAGCCAACCAGCAGTTAATGGAGAAAAATCTGGCTCAC
rJMSF040N21+ AAAAAGGGTTCCTTACAATCAACAGCCAACCAGCAGTTAATGGAGAAAAATCTGGCTCAC
rJMFF036C04+ AAAAAGGGTTCCTTACAATCAACAGCCAACCAGCAGTTAATGGAGAAAAATCTGGCTCAC
rJMFF010E12+ AAAAAGGGTTCCTTACAATCAACAGCCAACCAGCAGTTAATGGAGAAAAATCTGGCTCAC
rJMFF010A05+ AAAAAGGGTTCCTTACAATCAACAGCCAACCAGCAGTTAATGGAGAAAAATCTGGCTCAC
                      ____________________________________________________________
consensus AAAAAGGGTTCCTTACAATCAACAGCCAACCAGCAGTTAATGGAGAAAAATCTGGCTCAC
 
. : . : . : . : . : . :
rJMSF048E15+ CTTCTGTTGGTTGGGGTGGCCCTGGTGGCTATGTATATCAGAAGGCATATTTGGAGTTTT
rJMSF050D05+ CTTCTGTTGGTTGGGGTGGCCCTGGTGGCTATGTATATCAGAAGGCATATTTGGAGTTTT
rJMSF040N21+ CTTCTGTTGGTTGGGGTGGCCCTGGTGGCTATGTATATCAGAAGGCATATTTGGAGTTTT
rJMFF036C04+ CTTCTGTTGGTTGGGGTGGCCCTGGTGGCTATGTATATCAGAAGGCATATTTGGAGTTTT
rJMFF010E12+ CTTCTGTTGGTTGGGGTGGCCCTGGTGGCTATGTATATCAGAAGGCATATTTGGAGTTTT
rJMFF010A05+ CTTCTGTTGGTTGGGGTGGCCCTGGTGGCTATGTATATCAGAAGGCATATTTGGAGTTTT
                      ____________________________________________________________
consensus CTTCTGTTGGTTGGGGTGGCCCTGGTGGCTATGTATATCAGAAGGCATATTTGGAGTTTT
 
. : . : . : . : . : . :
rJMSF048E15+ TCTGCTCAAAGCAGAAGTTAGATGCCCTTGTTGAGAAATGCAAAACCTTCCCATCTCTCA
rJMSF050D05+ TCTGCTCAAAGCAGAAGTTAGATGCCCTTGTTGAGAAATGCAAAACCTTCCCATCTCTCA
rJMSF040N21+ TCTGCTCAAAGCAGAAGTTAGATGCCCTTGTTGAGAAATGCAAAACCTTCCCATCTCTCA
rJMFF036C04+ TCTGCTCAAAGCAGAAGTTAGATGCCCTTGTTGAGAAATGCAAAACCTTCCCATCTCTCA
rJMFF010E12+ TCTGCTCAAAGCAGAAGTTAGATGCCCTTGTTGAGAAATGCAAAACCTTCCCATCTCTCA
rJMFF010A05+ TCTGCTCAAAGCAGAAGTTAGATGCCCTTGTTGAGAAATGCAAAACCTTCCCATCTCTCA
                      ____________________________________________________________
consensus TCTGCTCAAAGCAGAAGTTAGATGCCCTTGTTGAGAAATGCAAAACCTTCCCATCTCTCA
 
. : . : . : . : . : . :
rJMSF048E15+ CCTACATTGCAGTGAATAAAGAAGGAACTTTGGTTTCTAATGTGGAGCAAACTGATGTGA
rJMSF050D05+ CCTACATTGCAGTGAATAAAGAAGGGACTTTGGTTTCTAATGTGGAGCAAACTGATGTGA
rJMSF040N21+ CCTACATTGCAGTGAATAAAGAAGGAACTTTGGTTTCTAATGTGGAGCAAACTGATGTGA
rJMFF036C04+ CCTACATTGCAGTGAATAAAGAAGGAACTTTGGTTTCTAATGTGGAGCAAACTGATGTGA
rJMFF010E12+ CCTACATTGCAGTGAATAAAGAAGGAACTTTGGTTTCTAATGTGGAGCAAACTGATGTGA
rJMFF010A05+ CCTACATTGCAGTGAATAAAGAAGGAACTTTGGTTTCTAATGTGGAGCAAACTGATGTGA
                      ____________________________________________________________
consensus CCTACATTGCAGTGAATAAAGAAGGAACTTTGGTTTCTAATGTGGAGCAAACTGATGTGA
 
. : . : . : . : . : . :
rJMSF048E15+ ATGCTGTGACATGGGGGGTCTTCCCAGCAAAGGAGATAATTCAACCAACAGTTGTTGATC
rJMSF050D05+ ATGCTGTGACATGGGGGGTCTTCCCAGCAAAGGAGATAATTCAACCAACAGTTGTTGATC
rJMSF040N21+ ATGCTGTGACATGGGGGGTCTTCCCAGCAAAGGAGATAATTCAACCAACAGTTGTTGATC
rJMFF036C04+ ATGCTGTGACATGGGGGGTCTTCCCAGCAAAGGAGATAATTCAACCAACAGTTGTTGATC
rJMFF010E12+ ATGCTGTGACATGGGGGGTCTTCCCAGCAAAGGAGATAATTCAACCAACAGTTGTTGATC
rJMFF010A05+ ATGCTGTGACATGGGGGGTCTTCCCAGCAAAGGAGATAATTCAACCAACAGTTGTTGATC
                      ____________________________________________________________
consensus ATGCTGTGACATGGGGGGTCTTCCCAGCAAAGGAGATAATTCAACCAACAGTTGTTGATC
 
. : . : . : . : . : . :
rJMSF048E15+ CTGTCAGCTTTATGATATGGAAGGATGAGGCTTTCGAAACATGGTCCAAGGGTTGGGGTC
rJMSF050D05+ CTGTCAGCTTTATGATATGGAAGGATGAGGCTTTCGAAACATGGTCCAAGGGTTGGGGTC
rJMSF040N21+ CTGTCAGCTTTATGATATGGAAGGATGAGGCTTTCGAAACATGGTCCAAGGGTTGGGGTC
rJMFF036C04+ CTGTCAGCTTTATGATATGGAAGGATGAGGCTTTCGAAACATGGTCCAAGGGTTGGGGTC
rJMFF010E12+ CTGTCAGCTTTATGATATGGAAGGATGAGGCTTTCGAAACATGGTCCAAGGGTTGGGGTC
rJMFF010A05+ CTGTCAGCTTTATGATATGGAAGGATGAGGCTTTCGAAACATGGTCCAAGGGTTGGGGTC
                      ____________________________________________________________
consensus CTGTCAGCTTTATGATATGGAAGGATGAGGCTTTCGAAACATGGTCCAAGGGTTGGGGTC
 
. : . : . : . : . : . :
rJMSF048E15+ AGCTATACCCCGAGTCTGATCTCTCCAGAAAGTTGCTTGAAGAGGTTCAAAAGACTTTTT
rJMSF050D05+ AGCTATACCCCGAGTCTGATCTCTCCAGAAAGTTGCTTGAAGAGGTTCAAAAGACTTTTT
rJMSF040N21+ AGCTATACCCCGAGTCTGATCTCTCCAGAAAGTTGCTTGAAGAGGTTCAAAAGACTTTTT
rJMFF036C04+ AGCTATACCCCGAGTCTGATCTCTCCAGAAAGTTGCTTGAAGAGGTTCAAAAGACTTTTT
rJMFF010E12+ AGCTATACCCCGAGTCTGATCTCTCCAGAAAGTTGCTTGAAGAGGTTCAAAAGACTTTTT
rJMFF010A05+ AGCTATACCCCGAGTCTGATCTCTCCAGAAAGTTGCTTGAAGAGGTTCAAAAGACTTTTT
                      ____________________________________________________________
consensus AGCTATACCCCGAGTCTGATCTCTCCAGAAAGTTGCTTGAAGAGGTTCAAAAGACTTTTT
 
. : . : . : . : . : . :
rJMSF048E15+ TCTTGGTGAGTTTGGTGGACAATGATTACGTCCATGGTGATCTGTTTGCTATCTTCAAGG
rJMSF050D05+ TCTTGGTGAGTTTGGTGGACAATGATTACGTCCATGGTGATCTGTTTGCTATCTTCAAGG
rJMSF040N21+ TCTTGGTGAGTTTGGTGGACAATGATTACGTCCATGGTGATCTGTTTGCTATCTTCAAGG
rJMFF036C04+ TCTTGGTGAGTTTGGTGGACAATGATTACGTCCATGGTGATCTGTTTGCTATCTTCAAGG
rJMFF010E12+ TCTTGGTGAGTTTGGTGGACAATGATTACGTCCATGGTGATCTGTTTGCTATCTTCAAGG
rJMFF010A05+ TCTTGGTGAGTTTGGTGGACAATGATTACGTCCATGGTGATCTGTTTGCTATCTTCAAGG
                      ____________________________________________________________
consensus TCTTGGTGAGTTTGGTGGACAATGATTACGTCCATGGTGATCTGTTTGCTATCTTCAAGG
 
. : . : . : . : . : . :
rJMSF048E15+ ATCTGTGACCATCACTAGCAGAAGCACTATCAAATTCAATTCTTTTTGCTCAGTGATCGA
rJMSF050D05+ ATCTGTGACCATCACTAGCAGAAGCACTATCAAATTCAATTCTTTNTGCTCAGTGATCGA
rJMSF040N21+ ATCTGTGACCATCACTAGCAGAAGCACTATCAAATTCAATTCTTTTTGCTCAGTGATCGA
rJMFF036C04+ ATCTGTGACCATCACTAGCAGAAGCACTATCAAATTCAATTCTTTTTGCTCAGTGATCGA
rJMFF010E12+ ATCTGTGACCATCACTAGCAGAAGCACTATCAAATTCAATTCTTTTTGCTCAGTGATCGA
rJMFF010A05+ ATCTGTGACCATCACTAGCAGAAGCACTATCAAATTCAATTCTTTTTGCTCAGTGATCGA
                      ____________________________________________________________
consensus ATCTGTGACCATCACTAGCAGAAGCACTATCAAATTCAATTCTTTTTGCTCAGTGATCGA
 
. : . : . : . : . : . :
rJMSF048E15+ TCAAAGTTAATTCTTCCTTCTTGTTTTAAACATTTGTGTGTTACTTAAATTCTGGTATAA
rJMSF050D05+ TCAAAGTTAATTCTTCCTTCTTGTTTTAAACATTTGTGTGTTACTTAAATTCTGGTATAA
rJMSF040N21+ TCAAAGTTAATTCTTCCTTCTTGTTTTAAACATTTGTGTGTTACTTAAATTCTGGTATAA
rJMFF036C04+ TCAAAGTTAATTCTTCCTTCTTGTTTTAAACATTTGTGTGTTACTTAAATTCTGGTATAA
rJMFF010E12+ TCAAAGTTAATTCTTCCTTCTTGTTTTAAACATTTGTGTGTTACTTAAATTCTGGTATAA
rJMFF010A05+ TCAAAGTTAATTCTTCCTTCTTGTTTTAAACATTTGTGTGTTACTTAAATTCTGGTATAA
                      ____________________________________________________________
consensus TCAAAGTTAATTCTTCCTTCTTGTTTTAAACATTTGTGTGTTACTTAAATTCTGGTATAA
 
. : . : . : . : . : . :
rJMSF048E15+ CACTCTCATATTGTAATGT-ACTATTTCGGT
rJMSF050D05+ CACTCTCATATTGTAATGTA
rJMSF040N21+ CACTCTCATATTGTAATGTAACTATTTCGGTCACTCCAAGCAATT
rJMFF036C04+ CACTCTCATATTGTAATGT-ACTATTTCGGTCACTCCAAGCAATT
rJMFF010E12+ CACTCTCATATTGTAATGT-ACTATTTCGGTCACTCCAAGCAATT
rJMFF010A05+ CACTCTCATATTGTAATGT-ACTATTTCGGTCACTCCAAGCAATTTCATATGCAGAAACT
                      ____________________________________________________________
consensus CACTCTCATATTGTAATGT-ACTATTTCGGTCACTCCAAGCAATTTCATATGCAGAAACT