Previous Contig 008620:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009N02Sequence595003469 (4)716008620 (2)gb:AB015476_15125971e-19Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY091118_15743
JMFF026K04Sequence475003469 (4)586008620 (2)gb:AB006701_15099322e-17Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOP9.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009N02+ TTNTCAGGTGATGCGTCTGTTGCAGTGCNTTGGTCCGGCTTGAAATTTAGAGAGCC
                      ____________________________________________________________
consensus TTNTCAGGTGATGCGTCTGTTGCAGTGCNTTGGTCCGGCTTGAAATTTAGAGAGCC
 
. : . : . : . : . : . :
rJMFF009N02+ AGATAGCGGGTGTGAGTCAAATGGAGGCGATGAAACTTTAAATAGCGGTTTGCCCTTCTC
                      ____________________________________________________________
consensus AGATAGCGGGTGTGAGTCAAATGGAGGCGATGAAACTTTAAATAGCGGTTTGCCCTTCTC
 
. : . : . : . : . : . :
rJMFF026K04+ CTCTCTGGGCCATGAATTTTTCTTGGAGGCGATTCCTAAGTGCTCTGCAACTTG
rJMFF009N02+ TTTCACCTCTCTGGGCCATGAATTTTTCTTGGAGGCGATTCCTAAGTGCTCTGCAACTTG
                      ____________________________________________________________
consensus TTTCACCTCTCTGGGCCATGAATTTTTCTTGGAGGCGATTCCTAAGTGCTCTGCAACTTG
 
. : . : . : . : . : . :
rJMFF026K04+ GCCGGAGGAAAAGCTTCCTGTATCGAGTGCCCATAATTCACCGCCCATGTCCAAGTCTGA
rJMFF009N02+ GCCGGAGGAAAAGCTTCCTGTATCGAGTGCCCATAATTCACCGCCCATGTCCAAGTCTGA
                      ____________________________________________________________
consensus GCCGGAGGAAAAGCTTCCTGTATCGAGTGCCCATAATTCACCGCCCATGTCCAAGTCTGA
 
. : . : . : . : . : . :
rJMFF026K04+ ATACAAGTTCCTCAAGAGCTCTTACCAAATTTCATCTTCGAGTCACGCCTGGAGTTTAGT
rJMFF009N02+ ATACAAGTTCCTCAAGAGCTCTTACCAAATTTCATCTTCGAGTCACGCCTGGAGTTTAGT
                      ____________________________________________________________
consensus ATACAAGTTCCTCAAGAGCTCTTACCAAATTTCATCTTCGAGTCACGCCTGGAGTTTAGT
 
. : . : . : . : . : . :
rJMFF026K04+ TATTGTCACTGCAGGGTGGGATGGGCGGATTAGGTCGTTCCACAATTATGGATTGCCAGT
rJMFF009N02+ TATTGTCACTGCAGGGTGGGATGGGCGGATTAGGTCGTTCCACAATTATGGATTGCCAGT
                      ____________________________________________________________
consensus TATTGTCACTGCAGGGTGGGATGGGCGGATTAGGTCGTTCCACAATTATGGATTGCCAGT
 
. : . : . : . : . : . :
rJMFF026K04+ ACGGCTGTAAAGAAGAGAGTGGTCAGAAAACGCGAAAATAACATTTGAGTTGGCACGCCT
rJMFF009N02+ ACGGCTGTAAAGAAGAGAGTGGTCAGAAAACGCGAAAATAACATTTGAGTTGGCACGCCT
                      ____________________________________________________________
consensus ACGGCTGTAAAGAAGAGAGTGGTCAGAAAACGCGAAAATAACATTTGAGTTGGCACGCCT
 
. : . : . : . : . : . :
rJMFF026K04+ CAATGCTGCCGAAGCATGCATGTGATCTGGTCGTTCGAGAGAGAGAGTTGCAGGGCAGAG
rJMFF009N02+ CAATGCTGCCGAAGCATGCATGTGATCTGGTCGTTCGAGAGAGAGAGTTGCAGGGCAGAG
                      ____________________________________________________________
consensus CAATGCTGCCGAAGCATGCATGTGATCTGGTCGTTCGAGAGAGAGAGTTGCAGGGCAGAG
 
. : . : . : . : . : . :
rJMFF026K04+ GAGGCGTACGGAATGGCTCCATTTGGGTCCCTTGGGATATACATACATATATACATACAA
rJMFF009N02+ GAGGCGTACGGAATGGCTCCATTTGGGTCCCTTGGGATATACATACATATATACATACAA
                      ____________________________________________________________
consensus GAGGCGTACGGAATGGCTCCATTTGGGTCCCTTGGGATATACATACATATATACATACAA
 
. : . : . : . : . : . :
rJMFF026K04+ ACAACATGAGATTGCTGGTAGAGAGGGGAGTTTGTTTGATGTGGCCACTCAATCTCATTG
rJMFF009N02+ ACAACATGAGATTGCTGGTAGAGAGGGGAGTTTGTTTGATGTGGCCACTCAATCTCATTG
                      ____________________________________________________________
consensus ACAACATGAGATTGCTGGTAGAGAGGGGAGTTTGTTTGATGTGGCCACTCAATCTCATTG
 
. : . : . : . : . : . :
rJMFF026K04+ AGATAAGCCAAACACTCATCTCAGTTTGTATGTATGTATGTATGCATGTATTATTTGATT
rJMFF009N02+ AGATAAGCCAAACACTCATCTCAGTTTGTATGTATGTATGTATGCATGTATTATTTGATT
                      ____________________________________________________________
consensus AGATAAGCCAAACACTCATCTCAGTTTGTATGTATGTATGTATGCATGTATTATTTGATT
 
. : . : . : . : . : . :
rJMFF026K04+ TGGTTAGTTGGATGTGTGAAAGGGGGCCTAGAGAAATAAATAGAGATAAGGA
rJMFF009N02+ TGGTTAGTTGGATGTGTGAAAGGGGGCCTAGAGAAATAAATAGAGATAAGGATGAGGGGT
                      ____________________________________________________________
consensus TGGTTAGTTGGATGTGTGAAAGGGGGCCTAGAGAAATAAATAGAGATAAGGATGAGGGGT