Previous Contig 008614:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009L05Sequence610000514 (4)741008614 (3)gb:AK176239_18182275e-16Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-12-N11.
JMSF023L13Sequence660008614 (3)737008614 (3)gb:AK176239_18182272e-14Arabidopsis thaliana mRNA, complete cds, clone: RAFL23-12-N11.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023L13- GAATCACCTCGCCACTC
                      ____________________________________________________________
consensus GAATCACCTCGCCACTC
 
. : . : . : . : . : . :
JMSF023L13- TTCTTTCGTCCCAACTGCAGACTGCGGTGCTACAAAGGGGCCTGGCATAGAAAGAAACTA
                      ____________________________________________________________
consensus TTCTTTCGTCCCAACTGCAGACTGCGGTGCTACAAAGGGGCCTGGCATAGAAAGAAACTA
 
. : . : . : . : . : . :
JMSF023L13- GAAAGTCCATATTCCATTTCACAGGTCACAGCTTTGCCTTACGGCTCCCTCATTCATCAT
                      ____________________________________________________________
consensus GAAAGTCCATATTCCATTTCACAGGTCACAGCTTTGCCTTACGGCTCCCTCATTCATCAT
 
. : . : . : . : . : . :
JMSF023L13- GCGACTACATCTGGAAATCTGAACAAAAGCAGTGAAACAAATCGGATCTAAACAAATAGG
                      ____________________________________________________________
consensus GCGACTACATCTGGAAATCTGAACAAAAGCAGTGAAACAAATCGGATCTAAACAAATAGG
 
. : . : . : . : . : . :
JMSF023L13- TAGGATTTTATAAGCCAGTAATACTTTATGTTCTTATCCTGGTGTACAAAAGACAATTGA
                      ____________________________________________________________
consensus TAGGATTTTATAAGCCAGTAATACTTTATGTTCTTATCCTGGTGTACAAAAGACAATTGA
 
. : . : . : . : . : . :
JMSF023L13- ATACCGTCTTTTGTGTTGACGAATCCAACTGATTTGAGCAGCACTGCCGACTGCGACTCG
                      ____________________________________________________________
consensus ATACCGTCTTTTGTGTTGACGAATCCAACTGATTTGAGCAGCACTGCCGACTGCGACTCG
 
. : . : . : . : . : . :
JMSF023L13- TCTCGTCTCCCTCAGGCCTCACCTCTCCGTCAGCCCGTCGTCTACTCAACTTTGGTTGTC
                      ____________________________________________________________
consensus TCTCGTCTCCCTCAGGCCTCACCTCTCCGTCAGCCCGTCGTCTACTCAACTTTGGTTGTC
 
. : . : . : . : . : . :
JMSF023L13- GAATTGTAGAGTTGGAATTTACCCATCCTCCCCCAGTCTCGCTGCGCATCAACGCCAGAA
                      ____________________________________________________________
consensus GAATTGTAGAGTTGGAATTTACCCATCCTCCCCCAGTCTCGCTGCGCATCAACGCCAGAA
 
. : . : . : . : . : . :
JMSF023L13- TCTGCAAAGCTAAGAGTATGAGACGCAGGCACATAGTGATACAAGCCTGCAACCTCACAA
rJMSF023L13+ CTAAGAGTATGAGACGCAGGCACATAGTGATACAAGCCTGCAACCTCACAA
                      ____________________________________________________________
consensus TCTGCAAAGCTAAGAGTATGAGACGCAGGCACATAGTGATACAAGCCTGCAACCTCACAA
 
. : . : . : . : . : . :
JMSF023L13- TCTTTCTCTGACTGCAACAGAACCCTTGCCATATATGCCATCCACCGTTCTGGTTTTTTG
rJMSF023L13+ TCTTTCTCTGACTGCAACAGAACCCTTGCCATATATGCCATCCACCGTTCTGGTTTTTTG
                      ____________________________________________________________
consensus TCTTTCTCTGACTGCAACAGAACCCTTGCCATATATGCCATCCACCGTTCTGGTTTTTTG
 
. : . : . : . : . : . :
JMSF023L13- AAATCTCATCGGCTCAGTCTCTGTCTGCCAGCATCACCGTCAGATTGATATTCATTGCTG
rJMSF023L13+ AAATCTCATCGGCTCAGTCTCTGTCTGCCAGCATCACCGTCAGATTGATATTCATTGCTG
rJMFF009L05+ GTTGATATTCATTTCTG
                      ____________________________________________________________
consensus AAATCTCATCGGCTCAGTCTCTGTCTGCCAGCATCACCGTCAGATTGATATTCATTGCTG
 
. : . : . : . : . : . :
JMSF023L13- AGCAGATACTAGATAATGGATGAAGATAATAGATCTAGAAGAG
rJMSF023L13+ AGCAGATACTAGATAATGGATGAAGATAATAGATCTAGAAGAGAACGCAGGAAGGCTGCC
rJMFF009L05+ AGCAGATACTAGATAATGGATGAAGATAATAGATCTAGAAGAGAACGCAGGAAGGAAGCT
                      ____________________________________________________________
consensus AGCAGATACTAGATAATGGATGAAGATAATAGATCTAGAAGAGAACGCAGGAAGGCTGCT
 
. : . : . : . : . : . :
rJMSF023L13+ CGTTTATCGAAGAACAAGAAGAAGTTTGATTCATGGCTTCAACATCATCATAAATCATTG
rJMFF009L05+ CGTTTATCGATGAACAAGAAGAAGTTTGATTCATGGCTTCAACATCATCATAAATCATTG
                      ____________________________________________________________
consensus CGTTTATCGATGAACAAGAAGAAGTTTGATTCATGGCTTCAACATCATCATAAATCATTG
 
. : . : . : . : . : . :
rJMSF023L13+ CCAGTTTTGAAGTCAAAGCATGCAAAAATACAGCAGGGGATTGTAGGCCCAAAAAGTAGT
rJMFF009L05+ CCAGTTTTGAAGTCAAAGCATGCAAAAATACAGCAGGGGATTGTAGGCCCAAAAAGTAGT
                      ____________________________________________________________
consensus CCAGTTTTGAAGTCAAAGCATGCAAAAATACAGCAGGGGATTGTAGGCCCAAAAAGTAGT
 
. : . : . : . : . : . :
rJMSF023L13+ GAGGCTATGTCCAAGGATTCTGATAGTGAAGCAGAACATAACATTGAGCTTTCTCCAGTA
rJMFF009L05+ GAGGCTATGTCCAAGGATTCTGATAGTGAAGCAGAACATAACATTGAGCTTTCTCCAGTA
                      ____________________________________________________________
consensus GAGGCTATGTCCAAGGATTCTGATAGTGAAGCAGAACATAACATTGAGCTTTCTCCAGTA
 
. : . : . : . : . : . :
rJMSF023L13+ GTGGAAAACACAGAAGTTAAGACAAACAATTTGAAAAGGAAATGTGACTTAAGTTCAAAC
rJMFF009L05+ GTGGAAAACACAGAAGTTAAGACAAACAATTTGAAAAGGAAACGTGACTTAAGTTCAAAC
                      ____________________________________________________________
consensus GTGGAAAACACAGAAGTTAAGACAAACAATTTGAAAAGGAAATGTGACTTAAGTTCAAAC
 
. : . : . : . : . : . :
rJMSF023L13+ ACAAGGTTCAATGAATATCTGGAAATGGAGATGACAGGAGGGGTTAATTCTGCAGAGGAT
rJMFF009L05+ ACAAGGTTCAATGAATATCTGGAAATGGAGATGACAGGAGGGGTTAATTCTGCAGAGGAT
                      ____________________________________________________________
consensus ACAAGGTTCAATGAATATCTGGAAATGGAGATGACAGGAGGGGTTAATTCTGCAGAGGAT
 
. : . : . : . : . : . :
rJMSF023L13+ GATATGAGACTGGAAAGGAAACTTGCAAAGAAACTCAGAGTCAAGGATGGGAAACTGAGT
rJMFF009L05+ GATATGAGACTGGAAAGGAAACTTGCAAAGAAACTCAGAGTCAAGGATGGGAAACTGAGT
                      ____________________________________________________________
consensus GATATGAGACTGGAAAGGAAACTTGCAAAGAAACTCAGAGTCAAGGATGGGAAACTGAGT
 
. : . : . : . : . : . :
rJMSF023L13+ GGTGGTGATGATATTAATATGTTATTTGAAGGAATTCCGTCTATTCTTAACTCTGTTGAT
rJMFF009L05+ GGTGGTGATGATATTAATATGTTATTTGAAGGAATTCCGTCTATTCTTAACTCTGTTGGT
                      ____________________________________________________________
consensus GGTGGTGATGATATTAATATGTTATTTGAAGGAATTCCGTCTATTCTTAACTCTGTTGGT
 
. : . : . : . : . : . :
rJMSF023L13+ GAAGTACAAGAATTTTCAAAGGGTAAAAAGGGTCGCACTTCAGGCACGAAGAAGAAATTA
rJMFF009L05+ GAAGTACAAGAATTTTCAAAGGGTAAAAAGAGTCGCACTTCAGGCACGAAGAAGAAATTA
                      ____________________________________________________________
consensus GAAGTACAAGAATTTTCAAAGGGTAAAAAGGGTCGCACTTCAGGCACGAAGAAGAAATTA
 
. : . : . : . : . : . :
rJMSF023L13+ GTGGATGTGGATGTGAATGTAGTGGG
rJMFF009L05+ GTGGATGTGGATGTGAATGTAGTGGGTGAAGTAGTTGATAAAAGGGTTAGAAAATCTGAT
                      ____________________________________________________________
consensus GTGGATGTGGATGTGAATGTAGTGGGTGAAGTAGTTGATAAAAGGGTTAGAAAATCTGAT
 
. : . : . : . : . : . :
rJMFF009L05+ TCTATATCTGCTAGCTGCGATGGCTATAATCATATAGAGGAATTTGATGGGTAAAAGAAT
                      ____________________________________________________________
consensus TCTATATCTGCTAGCTGCGATGGCTATAATCATATAGAGGAATTTGATGGGTAAAAGAAT