Previous Contig 008609:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009J12Sequence589001166 (7)gb:AK118253_18162406e-48Arabidopsis thaliana At5g53390 mRNA for unknown protein, complete cds, clone: RA468008609 (3)pir|T45824|T458243e-13hypothetical protein F2K15.50 - Arabidopsis thaliana>gb:ATF2K15_1550525 Arabidop
JMFF032I02Sequence553001166 (7)gb:AK118253_18162405e-46Arabidopsis thaliana At5g53390 mRNA for unknown protein, complete cds, clone: RA681008609 (3)pir|T45825|T458252e-56hypothetical protein F2K15.60 - Arabidopsis thaliana>gb:ATF2K15_1550526 Arabidop
JMSF026L07Sequence672001166 (7)gb:AK118253_18162406e-48Arabidopsis thaliana At5g53390 mRNA for unknown protein, complete cds, clone: RA753008609 (3)gb:AK118253_18162402e-55Arabidopsis thaliana At5g53390 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF026L07+ TTCTTAACTATAGGTATCATAAAAGGGAGTGCAACCCATAACAAAAATAATCTGCCC
rJMFF032I02+ ATCATAAAAGGGAGTGCAACCAATAACAAAAATAATCTGCCC
                      ____________________________________________________________
consensus TTCTTAACTATAGGTATCATAAAAGGGAGTGCAACCCATAACAAAAATAATCTGCCC
 
. : . : . : . : . : . :
rJMSF026L07+ AAGAATGTTCGTC-TAGAGGGGCAATCATGTTCAACATCAGACCATCCACAGGAATAAAG
rJMFF032I02+ AAGAATGTTCGTCTTAGAGGGGCAATCATGTTCAACATCAGACCATCCACAGGAATAAAG
                      ____________________________________________________________
consensus AAGAATGTTCGTCTTAGAGGGGCAATCATGTTCAACATCAGACCATCCACAGGAATAAAG
 
. : . : . : . : . : . :
rJMSF026L07+ GCTTTAGCTGAGATGATGGAGAAGAAATCAAAAGCAAAATGGGGCAATAAGATTGGATAT
rJMFF032I02+ GCTTTAGCTGAGATGATGGAGAAGAAATCAAAAGCAAAATGGGGCAATAAGATTGGATAT
                      ____________________________________________________________
consensus GCTTTAGCTGAGATGATGGAGAAGAAATCAAAAGCAAAATGGGGCAATAAGATTGGATAT
 
. : . : . : . : . : . :
rJMSF026L07+ GCCTTAGCCCCATTATTCATTGGATTTCAAGATAACCCTTTGGATTATATCAGAAAAGCA
rJMFF032I02+ GCCTTAGCCCCATTATTCATTGGATTTCAAGATAACCCTTTGGATTATATCAGAAAAGCA
                      ____________________________________________________________
consensus GCCTTAGCCCCATTATTCATTGGATTTCAAGATAACCCTTTGGATTATATCAGAAAAGCA
 
. : . : . : . : . : . :
rJMSF026L07+ AAAGCCACCATTGATCGAAAGAAGCTCTCCATGGAGTCCAAACTTTCTTTCAGTGCTGCT
rJMFF032I02+ AAAGCCACCATTGATCGAAAGAAGCTCTCCATGGAGTCCAAACTTTCTTTCAGTGCTGCT
                      ____________________________________________________________
consensus AAAGCCACCATTGATCGAAAGAAGCTCTCCATGGAGTCCAAACTTTCTTTCAGTGCTGCT
 
. : . : . : . : . : . :
rJMSF026L07+ CATATCGTACTCAAGCTTTTTGGGGTTAAGGCTACTGCTGCTATGATAACTAGAGTTATA
rJMFF032I02+ CATATCGTACTCAAGCTTTTTGGGGTTAAGGCTACTGCTGCTATGATAACTAGAGTTATA
                      ____________________________________________________________
consensus CATATCGTACTCAAGCTTTTTGGGGTTAAGGCTACTGCTGCTATGATAACTAGAGTTATA
 
. : . : . : . : . : . :
rJMSF026L07+ TGTAACACAACTGTATCAATATCCAATGTTGTTGGACCTCAAGAAGAGATCTCATTTTTT
rJMFF032I02+ TGTAACACAACTGTATCAATATCCAATGTTGTTGGACCTCAAGAAGAGATCTCATTTTTT
rJMFF009J12+ CAATGTGGTTGGACNTCAAGAAGAGATCTCATTTTTT
                      ____________________________________________________________
consensus TGTAACACAACTGTATCAATATCCAATGTTGTTGGACCTCAAGAAGAGATCTCATTTTTT
 
. : . : . : . : . : . :
rJMSF026L07+ GGACATA-CTATGGCTTTTT-CTGCCCCCGCTGTTTATGGGGTACCTCATTCATTGACAA
rJMFF032I02+ GGACATA-CTATGGCTTTTT-CTGCCCCCGCTGTTTATGGGGTACCTCATTCATTGACAA
rJMFF009J12+ GGACATACCTATGGCTTTTTCCTNCCCCCGCTGTTTATGGGGTCCCTCATTCATTGACAA
                      ____________________________________________________________
consensus GGACATA-CTATGGCTTTTT-CTGCCCCCGCTGTTTATGGGGTACCTCATTCATTGACAA
 
. : . : . : . : . : . :
rJMSF026L07+ TACACTTCCAAAGCTATTGCAACAAGATGACGATATCAATGGCGGTTGATCCAGAAGTGA
rJMFF032I02+ TACACTTCCAAAGCTATTGCAACAAGATGACGATATCAATGGCGGTTGATCCAGAAGTGA
rJMFF009J12+ TACACTTCCAAAGCTATTGCANCAAGATGACGATATCAATGGCGGTTGATCCAGAAGTGA
                      ____________________________________________________________
consensus TACACTTCCAAAGCTATTGCAACAAGATGACGATATCAATGGCGGTTGATCCAGAAGTGA
 
. : . : . : . : . : . :
rJMSF026L07+ TTCCAGATCCATACCAACTGTGCGATGACTTGGAAGAGTCTCTTGTGATGTTTAAAGAGG
rJMFF032I02+ TTCCAGATCCATACCAACTGTGCGATGACTTGGAAGAGTCTCTTGTGATGTTTAAAGAGG
rJMFF009J12+ TTCCAGATCCATNCCAACTGTGCGATGACTTGGAAGAGTCTCTTGTGATGTTTAAAGAGG
                      ____________________________________________________________
consensus TTCCAGATCCATACCAACTGTGCGATGACTTGGAAGAGTCTCTTGTGATGTTTAAAGAGG
 
. : . : . : . : . : . :
rJMSF026L07+ CTGTGCTCACAACATCCACCCTTCATGCTTTACCTTAATTATTGCTATATTANTTCTTTG
rJMFF032I02+ CTGTGCTCACAACATCCACCCTTCATGCTTTACCTTAATTATTGCTATATTAATTCTTTG
rJMFF009J12+ CTGTGCTCACAACATCCACCCTTCATGCTTTACCTTAATTATTGCTATATTAATTCTTTG
                      ____________________________________________________________
consensus CTGTGCTCACAACATCCACCCTTCATGCTTTACCTTAATTATTGCTATATTAATTCTTTG
 
. : . : . : . : . : . :
rJMSF026L07+ TAGTTG
rJMFF032I02+ TAGTTGTT
rJMFF009J12+ TAGTTGTTATTAAGAGTTAATACCCAAAATGGTCCCTCGACTATGCCATAATTACCAATT
                      ____________________________________________________________
consensus TAGTTGTTATTAAGAGTTAATACCCAAAATGGTCCCTCGACTATGCCATAATTACCAATT
 
. : . : . : . : . : . :
rJMFF009J12+ TGGTCCTCAATTACCATTCTTACTCAATTAAGTCCTCAACTATGTAACTTTTACTCAATT
                      ____________________________________________________________
consensus TGGTCCTCAATTACCATTCTTACTCAATTAAGTCCTCAACTATGTAACTTTTACTCAATT
 
. : . : . : . : . : . :
rJMFF009J12+ AAGTCCTCAACTATACAATTCTTACCCAATTTAGTCCTCAACNANNCNATTNANNNCNAA
                      ____________________________________________________________
consensus AAGTCCTCAACTATACAATTCTTACCCAATTTAGTCCTCAACNANNCNATTNANNNCNAA