Previous Contig 008605:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009I07Sequence485000497 (3)pir|T48004|T480041e-45multifunctional aminoacyl-tRNA ligase-like protein - Arabidopsis thaliana>gb:ATT127008605 (4)
JMFF033H09Sequence522000497 (3)pir|T48004|T480049e-51multifunctional aminoacyl-tRNA ligase-like protein - Arabidopsis thaliana>gb:ATT730008605 (4)pir|T48004|T480041e-59multifunctional aminoacyl-tRNA ligase-like protein - Arabidopsis thaliana>gb:ATT
JMFF042A08Sequence635008605 (4)pir|T48004|T480041e-62multifunctional aminoacyl-tRNA ligase-like protein - Arabidopsis thaliana>gb:ATT213021628
JMSF045L14Sequence781000497 (3)pir|T48004|T48004e-104multifunctional aminoacyl-tRNA ligase-like protein - Arabidopsis thaliana>gb:ATT790008605 (4)pir|T48004|T480042e-80multifunctional aminoacyl-tRNA ligase-like protein - Arabidopsis thaliana>gb:ATT

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF045L14+ CGTGCGGAGGCGGACTTGAGAGATAACTATTCACCTGGGTGGA
                      ____________________________________________________________
consensus CGTGCGGAGGCGGACTTGAGAGATAACTATTCACCTGGGTGGA
 
. : . : . : . : . : . :
JMFF042A08- CTCTTAGGATTGAAATAGGACCCAAAGATC
rJMSF045L14+ AATATTCTAACTGGGAAATGAAGGGGGTTCCTCTTAGGATTGAAATAGGACCCAGAGACC
                      ____________________________________________________________
consensus AATATTCTAACTGGGAAATGAAGGGGGTTCCTCTTAGGATTGAAATAGGACCCAGAGATC
 
. : . : . : . : . : . :
JMFF042A08- TTGAAAAAAACCAGGTAAGAGCTGTCAGGCGTGACACTGGCTCTAAAGATGATATCCCAA
rJMSF045L14+ TTGACAATAACCAGGTAAGAGCTGTGAGGCGTGACAATGGTGCTAAAACCGACATTCCCA
rJMFF033H09+ AACCAGGTAAGAGCTGTGAGGCGTGACAATGGTGCTAAAACCGACATTCCCA
                      ____________________________________________________________
consensus TTGACAATAACCAGGTAAGAGCTGTGAGGCGTGACAATGGTGCTAAAACCGACATTCCCA
 
. : . : . : . : . : . :
JMFF042A08- TGGATAGCATAGCTGAACAAGTAAAAGACTTGCTCGCCACTATTCAACAAAATCTCTTTG
rJMSF045L14+ TGGCTAACATAGTTGAACAAGTAAAAGATATGCTCTCTACTATTCAACAAAATCTCTTTG
rJMFF033H09+ TGGCTAACATAGTTGAACAAGTAAAAGATATGCTCTCTACTATTCAACAAAATCTCTTTG
                      ____________________________________________________________
consensus TGGCTAACATAGTTGAACAAGTAAAAGATATGCTCTCTACTATTCAACAAAATCTCTTTG
 
. : . : . : . : . : . :
JMFF042A08- ATGTCGCAAAACAAAAACGAGATGCCTGCGTCCAGGTTGTGAAAACCTGGGACGAGTTTG
rJMSF045L14+ ATGTTGCAAAACAAAAGCGAGAAGCCTGTGTCCAGATTGTGAAAACCTGGGATGAATTTG
rJMFF033H09+ ATGTTGCAAAACAAAAGCGAGAAGCCTGTGTCCAGATTGTGAAAACCTGGGATGAATTTG
                      ____________________________________________________________
consensus ATGTTGCAAAACAAAAGCGAGAAGCCTGTGTCCAGATTGTGAAAACCTGGGATGAATTTG
 
. : . : . : . : . : . :
JMFF042A08- TGAAAGCTCTGAACCAAAAGAAGTTGGTCTTGGCTCCGTGGTGTGATGAAGAGGATGTTG
rJMSF045L14+ TGAATGCTCTGAATGGAAAGAAGTTGGTCTTGGCTCCTTGGTGTGATGAAGAGGATGTTG
rJMFF033H09+ TGAATGCTCTGAATGGAAAGAAGTTGGTCTTGGCTCCTTGGTGTGATGAAGAGGATGTTG
                      ____________________________________________________________
consensus TGAATGCTCTGAATGGAAAGAAGTTGGTCTTGGCTCCTTGGTGTGATGAAGAGGATGTTG
 
. : . : . : . : . : . :
JMFF042A08- AGAAGGATGTGAAGACACGGACGAAAGGAGAGATGGGTGCAGCAAAGACGCTATGTTCTC
rJMSF045L14+ AGAAAGACGTGAAGGCACGGACTAAAGGAGAGATGGGCGCAGCAAAGACACTTTGTTCTC
rJMFF033H09+ AGAAAGACGTGAAGGCACGGACTAAAGGAGAGATGGGCGCAGCAAAGACACTTTGTTCTC
                      ____________________________________________________________
consensus AGAAAGACGTGAAGGCACGGACTAAAGGAGAGATGGGCGCAGCAAAGACACTTTGTTCTC
 
. : . : . : . : . : . :
JMFF042A08- CATTCGACCAGCCTGAGCTACTAGAAGGAACCTTGTGCTTTGCCTCGGGCAAACCTGCGA
rJMSF045L14+ CATTTGACCAGCCTGAGCTGCCAGAAGGAACGCTGTGCTTTGCATCGGGCAAGCCTGCCA
rJMFF033H09+ CATTTGACCAGCCTGAGCTGCCAGAAGGAACGCTGTGCTTTGCATCGGGCAAGCCTGCCA
                      ____________________________________________________________
consensus CATTTGACCAGCCTGAGCTGCCAGAAGGAACGCTGTGCTTTGCATCGGGCAAGCCTGCCA
 
. : . : . : . : . : . :
JMFF042A08- AGAAATGGACTTACTGGGGCCGAAGTTATTGATA
rJMSF045L14+ AGAAATGGACTTACTGGGGCCGAAGTTATTGATATGTTAATTACACAATCATGATACTGT
rJMFF033H09+ AGAAATGGACTTACTGGGGCCGAAGTTATTGATATGTTAATTATACAATCATGATACTGT
                      ____________________________________________________________
consensus AGAAATGGACTTACTGGGGCCGAAGTTATTGATATGTTAATTATACAATCATGATACTGT
 
. : . : . : . : . : . :
rJMSF045L14+ AATCGTCTTGGACAAGAGTATACTTTCTGTTGGCTTCAGTTTTCGTGAAATAGAAGTGAA
rJMFF033H09+ AATCGTCTTGGACAAGAGTATACTTTCTGTTGGCTTCAGTTTTCGTGAAATAGAAGTGAA
                      ____________________________________________________________
consensus AATCGTCTTGGACAAGAGTATACTTTCTGTTGGCTTCAGTTTTCGTGAAATAGAAGTGAA
 
. : . : . : . : . : . :
rJMSF045L14+ GTGTCCCCATCAATTCTTACAAAGGAAATGAACTAATTTTATGACTAGAACTCTGTCATT
rJMFF033H09+ GTGTCCCCATCAATTCTTACAAAGGAAATGAACTAATTTTATGACTAGAACTCTGTCATT
                      ____________________________________________________________
consensus GTGTCCCCATCAATTCTTACAAAGGAAATGAACTAATTTTATGACTAGAACTCTGTCATT
 
. : . : . : . : . : . :
rJMSF045L14+ GATCACTGTTTGAACAATTCAGTTGAAGAAGTCATGTTTTCTTTTGTTCATTTGTCATTT
rJMFF033H09+ GATCACTGTTTGAACAATTCAGTTGAAGAAGTCATGTTTTCTTTTGTTCATTTGTCATTT
rJMFF009I07+ GTCATTT
                      ____________________________________________________________
consensus GATCACTGTTTGAACAATTCAGTTGAAGAAGTCATGTTTTCTTTTGTTCATTTGTCATTT
 
. : . : . : . : . : . :
rJMSF045L14+ TTAAAATCAG-TTTCTGTATTATGATATGAGTAGGCATTTTGGAGCACATTTCAAAGACC
rJMFF033H09+ TTAAAATCAG-TTTCTGTATTATGATATGAGTAGGCATTTTGGAGCACATTTCAAAGACC
rJMFF009I07+ TTAAAATCAGTTTTCTGTATTATGATATGAGTAGGCATTTTGGAGCACATTTCAAAGACC
                      ____________________________________________________________
consensus TTAAAATCAG-TTTCTGTATTATGATATGAGTAGGCATTTTGGAGCACATTTCAAAGACC
 
. : . : . : . : . : . :
rJMSF045L14+ CACAAGTGTTATATGGCTTTTTATGCTT
rJMFF033H09+ CACAAGTGTTATATGGCTTTTTATGCTTTGGTGGAGGAGATTATGATCTATTTATAAT
rJMFF009I07+ CACAAGTGTTATATGGCTTTTTATGCTTTGGTGGAGGAGATTATGATCTATTTATAATAT
                      ____________________________________________________________
consensus CACAAGTGTTATATGGCTTTTTATGCTTTGGTGGAGGAGATTATGATCTATTTATAATAT