Previous Contig 008601:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009H05Sequence561008601 (2)610008601 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF009H05- ACCTCCAAAA
rJMFF009H05+ ACCTCCAAAA
                      ____________________________________________________________
consensus ACCTCCAAAA
 
. : . : . : . : . : . :
JMFF009H05- GATGTGGAAAACTTTGGACCATGGATACTAGCACCCCGCAGGCAGAGAAGGAGGAGAATA
rJMFF009H05+ GATGTGGAAAACTTTGGACCATGGATACTAGCACCCCGCAGGCAGAGAAGGAGGAGAATA
                      ____________________________________________________________
consensus GATGTGGAAAACTTTGGACCATGGATACTAGCACCCCGCAGGCAGAGAAGGAGGAGAATA
 
. : . : . : . : . : . :
JMFF009H05- ACAGAGGGGAACCCGAGGAATGAGCAGCGACCAACAGCAGACCTGGTGGAAGAAGGCGGA
rJMFF009H05+ ACAGAGGGGAACCCGAGGAATGAGCAGCGACCAACAGCAGACCTGGTGGAAGAAGGCGGA
                      ____________________________________________________________
consensus ACAGAGGGGAACCCGAGGAATGAGCAGCGACCAACAGCAGACCTGGTGGAAGAAGGCGGA
 
. : . : . : . : . : . :
JMFF009H05- AGTTCGAGGTTTGCAGCCTTAAATTGGAAAGACAACGAGGCTGGGATCGAAGTAAATGAT
rJMFF009H05+ AGTTCGAGGTTTGCAGCCTTAAATTGGAAAGACAACGAGGCTGGGATCGAAGTAAATGAT
                      ____________________________________________________________
consensus AGTTCGAGGTTTGCAGCCTTAAATTGGAAAGACAACGAGGCTGGGATCGAAGTAAATGAT
 
. : . : . : . : . : . :
JMFF009H05- TCGCCCAGAGCATGGGAGATTAGGAACCAGAAAAGCTTTCAGAGTCGATGAGGAAGGCAG
rJMFF009H05+ TCGCCCAGAGCATGGGAGATTAGGAACCAGAAAAGCTTTCAGAGTCGATGAGGAAGGCAG
                      ____________________________________________________________
consensus TCGCCCAGAGCATGGGAGATTAGGAACCAGAAAAGCTTTCAGAGTCGATGAGGAAGGCAG
 
. : . : . : . : . : . :
JMFF009H05- CCGGTGCTACACAATATTGGGTATCGCCCAAGGAAGAATGTGGAGACATAATGTCACCCC
rJMFF009H05+ CCGGTGCTACACAATATTGGGTATCGCCCAAGGAAGAATGTGGAGACATAATGTCACCCC
                      ____________________________________________________________
consensus CCGGTGCTACACAATATTGGGTATCGCCCAAGGAAGAATGTGGAGACATAATGTCACCCC
 
. : . : . : . : . : . :
JMFF009H05- AAAGAGGTATGATCAATGTGGAAGCCAGAAAATTAAAACCAACTTTATGAATAAGGTACC
rJMFF009H05+ AAAGAGGTATGATCAATGTGGAAGCCAGAAAATTAAAACCAACTTTATGAATAAGGTACC
                      ____________________________________________________________
consensus AAAGAGGTATGATCAATGTGGAAGCCAGAAAATTAAAACCAACTTTATGAATAAGGTACC
 
. : . : . : . : . : . :
JMFF009H05- TAGACAAGTTGCATCCAAGGCAGAGCACATCATGGTTTGAGGCACTAAGGATGGAGATAT
rJMFF009H05+ TAGACAAGTTGCATCCAAGGCAGAGCACATCATGGTTTGAGGCACTAAGGATGGAGATAT
                      ____________________________________________________________
consensus TAGACAAGTTGCATCCAAGGCAGAGCACATCATGGTTTGAGGCACTAAGGATGGAGATAT
 
. : . : . : . : . : . :
JMFF009H05- CACTCGCTTGATAGTCCAAATTGAAGGGGCAGGAAACAAACGAATGTGATATGCCGGAGC
rJMFF009H05+ CACTCGCTTGATAGTCCAAATTGAAGGGGCAGGAAACAAACGAATGTGATATGCCGGAGC
                      ____________________________________________________________
consensus CACTCGCTTGATAGTCCAAATTGAAGGGGCAGGAAACAAACGAATGTGATATGCCGGAGC
 
. : . : . : . : . : . :
JMFF009H05- ATTTCCAAAGTCCCCCCCCTTAGTGATAATCCCCTACCAGGCGTAGATATGGAAGAGGGA
rJMFF009H05+ ATTTCCAAAGTCCCCCCCCTTAGTGATAATCCCCTACCAGGCGTAGATATGGAAGAGGGA
                      ____________________________________________________________
consensus ATTTCCAAAGTCCCCCCCCTTAGTGATAATCCCCTACCAGGCGTAGATATGGAAGAGGGA
 
. : . : . : . : . : . :
JMFF009H05- TGGAATCGAGG
rJMFF009H05+ TGGAATCGAGGACTCCGAATTCCCTAGTTCAACAGGATGACTATGGTATTTTATCAGGTT
                      ____________________________________________________________
consensus TGGAATCGAGGACTCCGAATTCCCTAGTTCAACAGGATGACTATGGTATTTTATCAGGTT