Previous Contig 008596:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009E03Sequence706008596 (2)gb:ATAC018907_15437052e-39Arabidopsis thaliana chromosome III BAC F28L1 genomic sequence, complete sequenc
JMSF018K10Sequence545019084gb:AC137925_17438146e-43Oryza sativa chromosome 3 BAC OSJNBb0047D08 genomic sequence, complete sequence.731008596 (2)gb:ATAC018907_15437054e-70Arabidopsis thaliana chromosome III BAC F28L1 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF018K10+ CATTTGCCGTTATAGCCNTGCACCCAAAGGTAAATGGA
                      ____________________________________________________________
consensus CATTTGCCGTTATAGCCNTGCACCCAAAGGTAAATGGA
 
. : . : . : . : . : . :
rJMSF018K10+ AGTCTGTTGCCTGCTTCTGTGATATCTATCTATTGTGCGTATGTGTGCTATACCGGTCTC
                      ____________________________________________________________
consensus AGTCTGTTGCCTGCTTCTGTGATATCTATCTATTGTGCGTATGTGTGCTATACCGGTCTC
 
. : . : . : . : . : . :
rJMSF018K10+ TCTAGTGAACCTCGAGATTATGCGTGCAATGGCCTGCACAAATCGAAAGCGGTTACTATC
                      ____________________________________________________________
consensus TCTAGTGAACCTCGAGATTATGCGTGCAATGGCCTGCACAAATCGAAAGCGGTTACTATC
 
. : . : . : . : . : . :
rJMSF018K10+ GGTACCCTCGTTCTTGGGATGCTTACGACAGTTCTCTCGGTTCTGTATTCTGCTCTTCGT
                      ____________________________________________________________
consensus GGTACCCTCGTTCTTGGGATGCTTACGACAGTTCTCTCGGTTCTGTATTCTGCTCTTCGT
 
. : . : . : . : . : . :
rJMSF018K10+ GCTGGGTCTTCGACCGCTTTTATGTCCCCGCCATCTTCTCCCAGATCAGGAGAAAGGAAA
rJMFF009E03+ CGCTTTTATGTCCCCGCCATCTTCTCCCAGATCAGGAGAAAGGAAA
                      ____________________________________________________________
consensus GCTGGGTCTTCGACCGCTTTTATGTCCCCGCCATCTTCTCCCAGATCAGGAGAAAGGAAA
 
. : . : . : . : . : . :
rJMSF018K10+ TCTCTTCTAGACTCTGACGAGCTGGAGTCTGGTAAAGCCAAGGGAGAACCGGTCAGTTAC
rJMFF009E03+ TCTCTTCTAGACTCTGACGAGCTGGAGTCTGGTAAAGCCAAGGGAGAACCGGTCAGTTAC
                      ____________________________________________________________
consensus TCTCTTCTAGACTCTGACGAGCTGGAGTCTGGTAAAGCCAAGGGAGAACCGGTCAGTTAC
 
. : . : . : . : . : . :
rJMSF018K10+ TCGTACTCGTTCTTCCATCTGATATTCACCTTGGCTAGCATGTATTCCGCCATGCTTCTC
rJMFF009E03+ TCGTACTCGTTCTTCCATCTGATATTCACCTTGGCTAGCATGTATTCCGCCATGCTTCTC
                      ____________________________________________________________
consensus TCGTACTCGTTCTTCCATCTGATATTCACCTTGGCTAGCATGTATTCCGCCATGCTTCTC
 
. : . : . : . : . : . :
rJMSF018K10+ GCCGGTTGGACTAGCAGCTCCGAGAGCACGGAGCTTATAGACGTCGGTTGGACCTCGGTT
rJMFF009E03+ GCCGGTTGGACTAGCAGCTCCGAGAGCACGGAGCTTATAGACGTCGGTTGGACCTCGGTT
                      ____________________________________________________________
consensus GCCGGTTGGACTAGCAGCTCCGAGAGCACGGAGCTTATAGACGTCGGTTGGACCTCGGTT
 
. : . : . : . : . : . :
rJMSF018K10+ TGGGTTCGTATTTGCACTGGGTGGGTCACCGCCGCTCTCTATCTTTGGTCCCTCGTCGCA
rJMFF009E03+ TGGGTTCGTATTTGCACTGGGTGGGTCACCGCCGCTCTCTATCTTTGGTCCCTCGTCGCA
                      ____________________________________________________________
consensus TGGGTTCGTATTTGCACTGGGTGGGTCACCGCCGCTCTCTATCTTTGGTCCCTCGTCGCA
 
. : . : . : . : . : . :
rJMSF018K10+ CCTCTGCTCTTCCCTGATCGTGAATTCTTCTGAATCTTGATCCTCTGATGGATTCATCGT
rJMFF009E03+ CCTCTGCTCTTCCCTGATCGTGAATTCTTCTGAATCTTGATCCTCTGATGGATTCATCGT
                      ____________________________________________________________
consensus CCTCTGCTCTTCCCTGATCGTGAATTCTTCTGAATCTTGATCCTCTGATGGATTCATCGT
 
. : . : . : . : . : . :
rJMSF018K10+ TCATCTTGGATGTTAATATGTGTGTGTGTGTGTGTTCCATTATATGTATCTACATGTTAT
rJMFF009E03+ TCATCTTGGATGTTAATATGTGTGTGTGTGTGTGTTCCATTATATGTATCTACATGTTAT
                      ____________________________________________________________
consensus TCATCTTGGATGTTAATATGTGTGTGTGTGTGTGTTCCATTATATGTATCTACATGTTAT
 
. : . : . : . : . : . :
rJMSF018K10+ ACGGGTTGTACCCAACTATTGATTGTTATAATCATGTTTGTATTGTGTTTCTGACTTGAT
rJMFF009E03+ ACGGGTTGTACCCAACTATTGATTGTTATAATCATGTTTGTATTGTGTTTCTGACTTGAT
                      ____________________________________________________________
consensus ACGGGTTGTACCCAACTATTGATTGTTATAATCATGTTTGTATTGTGTTTCTGACTTGAT
 
. : . : . : . : . : . :
rJMSF018K10+ AAACACTTGTTTATCTAAGTATGGTGAACATTA
rJMFF009E03+ AAACACTTGTTTATCTAAGTATGGTGAACATTACTAGTATTTAGCTTAAAGAAATTGTGT
                      ____________________________________________________________
consensus AAACACTTGTTTATCTAAGTATGGTGAACATTACTAGTATTTAGCTTAAAGAAATTGTGT
 
. : . : . : . : . : . :
rJMFF009E03+ TGACGTTATTTGTGATACCGCTCTTGCTCTAGAATCTAGTGGAGGAGGTAATTCTTATTG
                      ____________________________________________________________
consensus TGACGTTATTTGTGATACCGCTCTTGCTCTAGAATCTAGTGGAGGAGGTAATTCTTATTG
 
. : . : . : . : . : . :
rJMFF009E03+ GGGTGCGTTTTAATTAGTCTTTAGTACCTTGTTTTTTGTGACTGTTAGTAAAGTAAAATT
                      ____________________________________________________________
consensus GGGTGCGTTTTAATTAGTCTTTAGTACCTTGTTTTTTGTGACTGTTAGTAAAGTAAAATT
 
. : . : . : . : . : . :
rJMFF009E03+ TTGATTTATTTTGAATTGATTGACCAGTTGAACTTTGTTTGGAGTTAGCAAAGTAAAATT
                      ____________________________________________________________
consensus TTGATTTATTTTGAATTGATTGACCAGTTGAACTTTGTTTGGAGTTAGCAAAGTAAAATT