Previous Contig 008591:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I13Sequence612000486 (8)gb:AB045893_15204701e-41Nepenthes alata NaAP3 mRNA for aspartic proteinase 3, complete cds.778008591 (10)gb:TCA313385_17248605e-94Theobroma cacao mRNA for aspartic proteinase (ap2 gene).
JMFF007O19Sequence545000486 (8)gb:AB045893_15204701e-53Nepenthes alata NaAP3 mRNA for aspartic proteinase 3, complete cds.714008591 (10)gb:TCA313385_17248608e-83Theobroma cacao mRNA for aspartic proteinase (ap2 gene).
JMFF009C19Sequence682008591 (10)gb:TCA313385_17248607e-79Theobroma cacao mRNA for aspartic proteinase (ap2 gene).
JMFF009E15Sequence543000486 (8)gb:TCA313385_17248602e-04Theobroma cacao mRNA for aspartic proteinase (ap2 gene).694008591 (10)gb:TCA313385_17248602e-81Theobroma cacao mRNA for aspartic proteinase (ap2 gene).
JMFF009L17Sequence549000486 (8)gb:AB045893_15204702e-59Nepenthes alata NaAP3 mRNA for aspartic proteinase 3, complete cds.794008591 (10)gb:TCA313385_17248602e-85Theobroma cacao mRNA for aspartic proteinase (ap2 gene).
JMFF013G18Sequence492000486 (8)gb:AB045893_15204705e-48Nepenthes alata NaAP3 mRNA for aspartic proteinase 3, complete cds.759008591 (10)gb:TCA313385_17248601e-96Theobroma cacao mRNA for aspartic proteinase (ap2 gene).
JMFF022F10Sequence543000486 (8)gb:AB045893_15204707e-58Nepenthes alata NaAP3 mRNA for aspartic proteinase 3, complete cds.761008591 (10)gb:TCA313385_17248609e-89Theobroma cacao mRNA for aspartic proteinase (ap2 gene).
JMFF024D02Sequence474000486 (8)gb:AB045893_15204704e-48Nepenthes alata NaAP3 mRNA for aspartic proteinase 3, complete cds.731008591 (10)gb:TCA313385_17248607e-90Theobroma cacao mRNA for aspartic proteinase (ap2 gene).
JMFF030G18Sequence482000486 (8)gb:AB045893_15204706e-48Nepenthes alata NaAP3 mRNA for aspartic proteinase 3, complete cds.666008591 (10)gb:TCA313385_17248605e-78Theobroma cacao mRNA for aspartic proteinase (ap2 gene).
JMFN014H02Sequence390008591 (10)gb:AB091762_15250653e-33Glycine max soyAP4 mRNA for aspartic proteinase 4, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013G18+ CTGGTCCATCGAGTATTATTAC
                      ____________________________________________________________
consensus CTGGTCCATCGAGTATTATTAC
 
. : . : . : . : . : . :
rJMFF013G18+ CATGATCAATCACGCCATTGGAGCTGATGGAGTAGTTAGCAAGGAATGCAAAG-CCGTGG
rJMFF024D02+ GGAGCTGATGGAGTAGTTAGCAAGGAATGCAAAG-CCGTGG
rJMFF009L17+ CATGATCAATCACGCCATTGGAGCTGATGGAGTAGTTAGCAAGGAATGCAAAGCCCGTGG
rJMFF022F10+ ATGGAGTAGTTAGCAAGGAATGCAAAG-CCGTGG
rJMFF003I13+ CATGATCAATCACGCCATTGGAGCTGATGGAGTAGTTAGCAAGGAATGCAAAG-CCGTGG
                      ____________________________________________________________
consensus CATGATCAATCACGCCATTGGAGCTGATGGAGTAGTTAGCAAGGAATGCAAAG-CCGTGG
 
. : . : . : . : . : . :
rJMFF013G18+ TTGAAAACTATGGACAAAGAATGATTGATTTGCTTGTAATGGAGTCACGTCCAAAGAAGA
rJMFF024D02+ TTGAAAACTATGGACAAAGAATGATTGATTTGCTTGTAATGGAGGCACGTCCAAAGAAGA
rJMFF009E15+ ACAAAGAATGATTGATTTGCTNGTAATGGAGGCACGTCCAAAGAAGA
rJMFF030G18+ CCAAAGAAGA
rJMFF009L17+ TTGAAAACTATGGAC--AGAATGATTGATTTGCTTGTAATGGAGGCACGTCCAAAGAAGA
rJMFF022F10+ TTGAAAACTATGGACAAAGAATGATTGATTTGCTTGTAATGGAGGCACGTCCAAAGAAGA
rJMFF003I13+ TTGAAAACTATGGACAAAGAATGATTGATTTGCTTGTAATGGAGGCACGTCCAAAGAAGA
rJMFF007O19+ AACTATGGACAAAGAATGATTGATTTGCTTGTAATGGAGGCACGTCCAAAGAAGA
rJMFF009C19+ ATGGAGGCACGTCCAAAGAAGA
                      ____________________________________________________________
consensus TTGAAAACTATGGACAAAGAATGATTGATTTGCTTGTAATGGAGGCACGTCCAAAGAAGA
 
. : . : . : . : . : . :
rJMFF013G18+ TATGCTCGCAAATTGGGTTATGCACCTTCAATGGAAACCGTGGTGTTAGCATGGGAATCG
rJMFF024D02+ TATGCTCGCAAATTGGGTTATGCACCTTCAATGGAAACCGTGGTGTTAGCATGGGAATCG
rJMFF009E15+ TATGCTCGCAAATTGGGTTATGCACCTTCAATGGAAACCGTGGTGTTAGCATGGGAATCG
rJMFF030G18+ TATGCTCGCAAATTGGGTTATGCACNTTCAATGGAANCCGTGGTGTTAGCATGGGAATCG
rJMFF009L17+ TATGCTCGCAAATTGGGTTATGCACCTTCAATGGAAACCGTGGTGTTAGCATGGGAATCG
rJMFF022F10+ TATGCTCGCAAATTGGGTTATGCACCTTCAATGGAAACCGTGGTGTTAGCATGGGAATCG
rJMFF003I13+ TATGCTCGCAAATTGGGTTATGCACCTTCAATGGAAACCGTGGTGTTAGCATGGGAATCG
rJMFF007O19+ TATGCTCGCAAATTGGGTTATGCACCTTCAATGGAAACCGTGGTGTTAGCATGGGAATCG
rJMFF009C19+ TATGCTCGCAAATTGGGTTATGCACCTTCAATGGAAACCGTGGTGTTAGCATGGGAATCG
                      ____________________________________________________________
consensus TATGCTCGCAAATTGGGTTATGCACCTTCAATGGAAACCGTGGTGTTAGCATGGGAATCG
 
. : . : . : . : . : . :
rJMFF013G18+ AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
rJMFF024D02+ AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
rJMFF009E15+ AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
rJMFF030G18+ AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
rJMFF009L17+ AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
rJMFF022F10+ AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
rJMFF003I13+ AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
rJMFF007O19+ AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
rJMFF009C19+ AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
                      ____________________________________________________________
consensus AGAGCGTTGTAGATGAGAAAAATGGGGTATCAGCCGATCTACATGATGCTATGTGCTCGG
 
. : . : . : . : . : . :
rJMFF013G18+ CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
rJMFF024D02+ CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
rJMFF009E15+ CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
rJMFF030G18+ CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
rJMFF009L17+ CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
rJMFF022F10+ CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
rJMFF003I13+ CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
rJMFF007O19+ CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
rJMFF009C19+ CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
                      ____________________________________________________________
consensus CTTGTGAAATGACGGTTGTTTGGATGCAGAATCAACTTAGCGAGAATCAGACTCAAGAAA
 
. : . : . : . : . : . :
rJMFF013G18+ ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
rJMFF024D02+ ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
rJMFF009E15+ ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
rJMFF030G18+ ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
rJMFF009L17+ ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
rJMFF022F10+ ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
rJMFF003I13+ ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
rJMFF007O19+ ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
rJMFF009C19+ ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
                      ____________________________________________________________
consensus ACATTTTGTCTTATGTGAATGAGCTTTGCAACCGGCTACCGAGCCCCATGGGAGAATCAG
 
. : . : . : . : . : . :
rJMFF013G18+ GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
rJMFF024D02+ GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
rJMFF009E15+ GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
rJMFF030G18+ GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
rJMFF009L17+ GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
rJMFF022F10+ GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
JMFN014H02- CTTCTCAATTGGTGGAAAAG
rJMFF003I13+ GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
rJMFF007O19+ GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
rJMFF009C19+ GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
                      ____________________________________________________________
consensus GCGTCGACTGTGGAAAGCTTTCCACCATGCCTTCTGTTTCCTTCTCAATTGGTGGAAAAG
 
. : . : . : . : . : . :
rJMFF013G18+ TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
rJMFF024D02+ TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
rJMFF009E15+ TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
rJMFF030G18+ TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
rJMFF009L17+ TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
rJMFF022F10+ TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
JMFN014H02- TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
rJMFF003I13+ TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
rJMFF007O19+ TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
rJMFF009C19+ TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
                      ____________________________________________________________
consensus TGTTCGACCTCTCCCCTAATGAGTACATACTGAAGGTGGGCGAGGGAAGCGCAGCACAGT
 
. : . : . : . : . : . :
rJMFF013G18+ GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
rJMFF024D02+ GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
rJMFF009E15+ GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
rJMFF030G18+ GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
rJMFF009L17+ GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
rJMFF022F10+ GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
JMFN014H02- GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
rJMFF003I13+ GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
rJMFF007O19+ GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
rJMFF009C19+ GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
                      ____________________________________________________________
consensus GCATTAGTGGCTTCACGGCTTTGGATGTCCCTCCTCCTCGCGGACCTCTCTGGATATTGG
 
. : . : . : . : . : . :
rJMFF013G18+ GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
rJMFF024D02+ GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
rJMFF009E15+ GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
rJMFF030G18+ GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
rJMFF009L17+ GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
rJMFF022F10+ GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
JMFN014H02- GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
rJMFF003I13+ GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
rJMFF007O19+ GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
rJMFF009C19+ GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
                      ____________________________________________________________
consensus GAGATGTTTTCATGGGCAGATACCACACTGTGTTTGATTATGGCAAGATGAGGGTTGGAT
 
. : . : . : . : . : . :
rJMFF013G18+ TTGCTGAAGCAGCTTAATGCCCCCTATTATCCCTTTATTCATTTTCTTGCTGCCATTATC
rJMFF024D02+ TTGCTGAAGCAGCTTAATGCCCCCTATTATCCCTTTATTCATTTTCTTGCTGCCATTATC
rJMFF009E15+ TTGCTGAAGCAGCTTAATGCCCCCTATTATCCCTTTATTCATTTTCTTGCTGCCATTATC
rJMFF030G18+ TTGCTGAAGCAGCTTAATGCCCCCTATTATCCCTTTATTCATTTTCTTGCTGCCATTATC
rJMFF009L17+ TTGCTGAAGCAG
rJMFF022F10+ TTGCTGAAGCAG
JMFN014H02- TTGCTGAAGCAG
rJMFF003I13+ TTGCTGAAGCAGCTTAATGCCCCCTATTATCCCTTTATTCATTTTCTTGCTGCCATTATC
rJMFF007O19+ TTGCTGAAGCAGCTTAATGCCCCCTATTATCCCTTTATTCATTTTCTTGCTGCCATTATC
rJMFF009C19+ TTGCTGAAGCAGCTTAATGCCCCCTATTATCCCTTTATTCATTTTCTTGCTGCCATTATC
                      ____________________________________________________________
consensus TTGCTGAAGCAGCTTAATGCCCCCTATTATCCCTTTATTCATTTTCTTGCTGCCATTATC
 
. : . : . : . : . : . :
rJMFF013G18+ TAATATGTATGAGTGGTTTAATTTAAGTAGATAGATGTACTTGCGAATCTGGGCATATAT
rJMFF024D02+ TAATATGTATGAGTGGTTTAATTTAAGTAGATAGATGTTCTTGCGAATCTGGGCATATAT
rJMFF009E15+ TAATATGTATGAGTGGTTTAATTTAAGTAGATAGATGTACTTGCGAATCTGGGCATATAT
rJMFF030G18+ TAATATGTATGAGTGGTTTAATTTAAGTAGATAGATGTACTTGCGAATCTGGGCATATAT
rJMFF003I13+ TAATATGTATGAGTGGTTTAATTTAAGTAGATAGATGTACTTGCGAATCTGGGCATATAT
rJMFF007O19+ TAATATGTATGAGTGGTTTAATTTAAGTAGATAGATGTACTTGCGAATCTGGGCATATAT
rJMFF009C19+ TAATATGTATGAGTGGTTTAATTTAAGTAGATAGATGTACTTGCGAATCTGGGCATATAT
                      ____________________________________________________________
consensus TAATATGTATGAGTGGTTTAATTTAAGTAGATAGATGTACTTGCGAATCTGGGCATATAT
 
. : . : . : . : . : . :
rJMFF013G18+ AGACGTACATT
rJMFF024D02+ AGACGTACATTTGTAAACTATGATTATACTA
rJMFF009E15+ AGACGTACATTTGTAAACTATGATTATACTATGGTGTTTGGTTTGGT
rJMFF030G18+ AGACGTACATTTGTAAACTATGATTATACTATGGTGTTTGGTTTGGTCCTATAAAA
rJMFF003I13+ AGACGTACATTTGTAAACTATGATTATACTATGGTGTTTGGTTTGGTCCTATAAAA
rJMFF007O19+ AGACGTACATTTGTAAACTATGATTATACTATGGTGTTTGGTTTGGTCCTATAAAATAC
rJMFF009C19+ AGACGTACATTTGTAAACTATGATTATACTATGGTGTTTGGTTTGGTCCTATAAAATACT
                      ____________________________________________________________
consensus AGACGTACATTTGTAAACTATGATTATACTATGGTGTTTGGTTTGGTCCTATAAAATACT