Previous Contig 008590:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009C04Sequence530000475 (2)gb:AB019235_15142192e-16Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMI9.738008590 (2)gb:AP003221_18255042e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P000
JMFF016N17Sequence522000475 (2)gb:AB019235_15142191e-13Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMI9.162008590 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009C04+ GGAGGCGGAGGAGAAGAAG
                      ____________________________________________________________
consensus GGAGGCGGAGGAGAAGAAG
 
. : . : . : . : . : . :
rJMFF009C04+ TTAGGACAGCCACTCGACAACAGCATTGAGGTCTTGATTGATAACAACCCGGAATTCTTA
                      ____________________________________________________________
consensus TTAGGACAGCCACTCGACAACAGCATTGAGGTCTTGATTGATAACAACCCGGAATTCTTA
 
. : . : . : . : . : . :
rJMFF009C04+ ATTCCCATGACAGAGAATTTCACATTGCATCCCTTCCTTACAAGCCGGACTTCAAGGTTA
                      ____________________________________________________________
consensus ATTCCCATGACAGAGAATTTCACATTGCATCCCTTCCTTACAAGCCGGACTTCAAGGTTA
 
. : . : . : . : . : . :
rJMFF009C04+ TGCCCGAGGGTTGGGATGGCACCACTAGGGACCCCGATGAGGTGCACTATGAAATATCAA
                      ____________________________________________________________
consensus TGCCCGAGGGTTGGGATGGCACCACTAGGGACCCCGATGAGGTGCACTATGAAATATCAA
 
. : . : . : . : . : . :
rJMFF009C04+ TGAAAGAAGATGAGATGTTGTATCAGGAATTTGTCCAAAAGTTCAACTTCAACAAAATGA
                      ____________________________________________________________
consensus TGAAAGAAGATGAGATGTTGTATCAGGAATTTGTCCAAAAGTTCAACTTCAACAAAATGA
 
. : . : . : . : . : . :
rJMFF009C04+ AGATGGAAAAGAAAGTTAAGTGCCACAAGTACAGCCGGATGCGCCCAACGCAAGGATGGA
                      ____________________________________________________________
consensus AGATGGAAAAGAAAGTTAAGTGCCACAAGTACAGCCGGATGCGCCCAACGCAAGGATGGA
 
. : . : . : . : . : . :
rJMFF009C04+ ACTTCACAGTCGAGAAGTTAGGACATCGTGGGAAGCGCGGGAATGGCGGTGGGTGGAAGT
                      ____________________________________________________________
consensus ACTTCACAGTCGAGAAGTTAGGACATCGTGGGAAGCGCGGGAATGGCGGTGGGTGGAAGT
 
. : . : . : . : . : . :
rJMFF009C04+ TCGTTAGTGTTGCAGACGGATCTAGTCGCCCTCTTAATGATTTTGAGAAGATGTTTGTGA
                      ____________________________________________________________
consensus TCGTTAGTGTTGCAGACGGATCTAGTCGCCCTCTTAATGATTTTGAGAAGATGTTTGTGA
 
. : . : . : . : . : . :
rJMFF009C04+ AGAGGGAAACCCCTCGACGACGCAGAAAGATCCTCCCATGATTCAACTCACTGCTGCGAC
                      ____________________________________________________________
consensus AGAGGGAAACCCCTCGACGACGCAGAAAGATCCTCCCATGATTCAACTCACTGCTGCGAC
 
. : . : . : . : . : . :
rJMFF016N17+ TAGTGTCTGCACAATGCTGTAGG
rJMFF009C04+ CTGGGGCTGAAATATTTGAAAGGCTTACATTTCTCTGTAGTGTCTGCACAATGCTGTAGG
                      ____________________________________________________________
consensus CTGGGGCTGAAATATTTGAAAGGCTTACATTTCTCTGTAGTGTCTGCACAATGCTGTAGG
 
. : . : . : . : . : . :
rJMFF016N17+ CTTAAGTTCCTGGATCTTTAAGGATTCAGNNTAAATTGTTTGAACATAGTAATTTTTGTA
rJMFF009C04+ CTTAAGTTCCTGGATCTTTAAGGATTCAGACTAAATTGTTTGAACATAGTAATTTTTGTA
                      ____________________________________________________________
consensus CTTAAGTTCCTGGATCTTTAAGGATTCAGACTAAATTGTTTGAACATAGTAATTTTTGTA
 
. : . : . : . : . : . :
rJMFF016N17+ ATGTTTTGCTGGAATTTAAATATCTTTTCTCNATACTNGCATTGGCTCTTCTGGTTGAAT
rJMFF009C04+ ATGTTTTGCTGGAATTTAAATATCTTTTCTCTTTACTTGCATTGGCTCTTTTGGTTGAAT
                      ____________________________________________________________
consensus ATGTTTTGCTGGAATTTAAATATCTTTTCTCTTTACTTGCATTGGCTCTTTTGGTTGAAT
 
. : . : . : . : . : . :
rJMFF016N17+ GTNGTATTAGAGATAGT
rJMFF009C04+ GTTG-ATTAGAGATAGTGAGATTACATGTACGGATGTACCTTTTCATCATGGCTAAGAAA
                      ____________________________________________________________
consensus GTTGTATTAGAGATAGTGAGATTACATGTACGGATGTACCTTTTCATCATGGCTAAGAAA