Previous Contig 008587:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009C01Sequence612000473 (4)gb:AB006698_15098732e-18Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCL19.>gb:AY070105_1566688008587 (4)pir|T04534|T045341e-09hypothetical protein F28J12.40 - Arabidopsis thaliana>gb:ATCHRIV48_1545639 Arabi
JMFF010D17Sequence271000473 (4)691008587 (4)pir|T04534|T045344e-30hypothetical protein F28J12.40 - Arabidopsis thaliana>gb:ATCHRIV48_1545639 Arabi
JMFF022H09Sequence452000473 (4)gb:AB006698_15098737e-15Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCL19.>gb:AY070105_1566699008587 (4)pir|T04534|T045347e-31hypothetical protein F28J12.40 - Arabidopsis thaliana>gb:ATCHRIV48_1545639 Arabi
JMSF051B08Sequence693000473 (4)gb:AB006698_15098732e-25Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCL19.>gb:AY070105_1566797008587 (4)pir|T04534|T045346e-43hypothetical protein F28J12.40 - Arabidopsis thaliana>gb:ATCHRIV48_1545639 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051B08+ GCAGAGCATAAACTCGG
                      ____________________________________________________________
consensus GCAGAGCATAAACTCGG
 
. : . : . : . : . : . :
rJMSF051B08+ ATAGTTNGGTTTGACCGACACGGATGGCCAGGGAGTTCTGTGTATGAACAGGGAGCAGCC
                      ____________________________________________________________
consensus ATAGTTNGGTTTGACCGACACGGATGGCCAGGGAGTTCTGTGTATGAACAGGGAGCAGCC
 
. : . : . : . : . : . :
rJMSF051B08+ TGAGGAGCTGAGAGTGAAGCCACTCTCCGCATCCTCGGCCTCCAAGCGAACTTTGGTGCC
rJMFF010D17+ GCCTCCAAGCGAACTTTGGTGCC
rJMFF022H09+ GCCTCCAAGCGAACTTTGGTGCC
                      ____________________________________________________________
consensus TGAGGAGCTGAGAGTGAAGCCACTCTCCGCATCCTCGGCCTCCAAGCGAACTTTGGTGCC
 
. : . : . : . : . : . :
rJMSF051B08+ GGCTCTGAATATGCGCCTCTGGTACGCTCCACATTTGGAGTTACCAGATGGAACAGTGCT
rJMFF010D17+ GGCTCTGAATATGCGCCTCTGGTACGCTCCACATTTGGAGTTACCAGATGGAACAGTGCT
rJMFF022H09+ GGCTCTGAATATGCGCCTCTGGTACGCTCCACATTTGGAGTTACCAGATGGAACAGTGCT
                      ____________________________________________________________
consensus GGCTCTGAATATGCGCCTCTGGTACGCTCCACATTTGGAGTTACCAGATGGAACAGTGCT
 
. : . : . : . : . : . :
rJMSF051B08+ TAAAGGTGCGACCTTGGTGGCTATTAGGCCCAGCGAGCAGCACAAGAAAGATGTGGTTGG
rJMFF010D17+ TAAAGGTGCGACCTTGGTGGCTATTAGGCCCAGCGAGCAGCACAAGAAAGATGTGGTTGG
rJMFF022H09+ TAAAGGTGCGACCTTGGTGGCTATTAGGCCCAGCGAGCAGCACAAGAAAGATGTGGTTGG
rJMFF009C01+ GCGAGCAGCACAAGAAAGATGTGGTTGG
                      ____________________________________________________________
consensus TAAAGGTGCGACCTTGGTGGCTATTAGGCCCAGCGAGCAGCACAAGAAAGATGTGGTTGG
 
. : . : . : . : . : . :
rJMSF051B08+ GTCAGATGGGAATTGGGTAGCTTCGGCTTTCGATGAACCCTATGGGGCAGCTGCAAGGAT
rJMFF010D17+ GTCAGATGGGAATTGGGTAGCTTCGGCTTTCGATGAACCCTATGGGGCAGCTGCAAGGAT
rJMFF022H09+ GTCAGATGGGAATTGGGTAGCTTCGGCTTTCGATGAACCCTATGGGGCAGCTGCAAGGAT
rJMFF009C01+ GTCAGATGGGAATTGGGTAGCTTCGGCTTTCGATGAACCCTATGGGGCAGCTGCAAGGAT
                      ____________________________________________________________
consensus GTCAGATGGGAATTGGGTAGCTTCGGCTTTCGATGAACCCTATGGGGCAGCTGCAAGGAT
 
. : . : . : . : . : . :
rJMSF051B08+ GCTGGTGAAGAGGAGAACCTACTGTCTTGAAATGAACTCGTTCTGAAAGCGAATCAAGAA
rJMFF010D17+ GCTGGTGAAGAGGAGAACCTACTGTCTTGGAATGAACTCGTTCTGAAAGCGAATCAAGAA
rJMFF022H09+ GCTGGTGAAGAGGAGAACCTACTGTCTTGAAATGAACTCGTTCTGAAAGCGAATCAAGAA
rJMFF009C01+ GCTGGTGAAGAGGAGAACCTACTGTCTTGAAATGAACTCGTTCTGAAAGCGAATCAAGAA
                      ____________________________________________________________
consensus GCTGGTGAAGAGGAGAACCTACTGTCTTGAAATGAACTCGTTCTGAAAGCGAATCAAGAA
 
. : . : . : . : . : . :
rJMSF051B08+ TTCGTTAGATGGATCTCTAAGCTG----AGGTTGCTGCTTTTGATGAAAGATGGATTCAC
rJMFF010D17+ TTCGTTAGATGGATCTCTAAGCTGAGGAAGGTTGCTGCTTTTGATGAAAGATGGATTCAC
rJMFF022H09+ TTCGTTAGATGGATCTCTAAGCTGAGGAAGGTTGCTGCTTTTGATGAAAGATGGATTCAC
rJMFF009C01+ TTCGTTAGATGGATCTCTAAGCTGAGGAAGGTTGCTGCTTTTGATGAAAGATGGATTCAC
                      ____________________________________________________________
consensus TTCGTTAGATGGATCTCTAAGCTGAGGAAGGTTGCTGCTTTTGATGAAAGATGGATTCAC
 
. : . : . : . : . : . :
rJMSF051B08+ GTGTCATGGAAGGATGAGAAACAGTACAATTTTGTCTTGAGCCGCAATTGAGTTAATTGA
rJMFF010D17+ GTGTCATGGAAGGATGAGAAACAGTACAATTTTGTCTTGAGCCGCAATTGAGTTAATTGA
rJMFF022H09+ GTGTCATGGAAGGATGAGAAACAGTACAATTTTGTCTTGAGCCGCAATTGAGTTAATTGA
rJMFF009C01+ GTGTCATGGAAGGATGAGAAACAGTACAATTTTGTCTTGAGCCGCAATTGAGTTAATTGA
                      ____________________________________________________________
consensus GTGTCATGGAAGGATGAGAAACAGTACAATTTTGTCTTGAGCCGCAATTGAGTTAATTGA
 
. : . : . : . : . : . :
rJMSF051B08+ GCCTCTTTACATATGAATCGTAAATTCGTAATGGAGCAATGCATGCTTCGGGAGATGAAA
rJMFF010D17+ GCCTCTTTACATATGAATCGTAAATTCGTAATGGTGCAATGCATGCTTCGGGAGATGAAA
rJMFF022H09+ GCCTCTTTACATATGAATCGTAAATTCGTAATGGAGCAATGCATGCTTCGGGAGATGAAA
rJMFF009C01+ GCCTCTTTACATATGAATCGTAAATTCGTAATGGAGCAATGCATGCTTCGGGAGATGAAA
                      ____________________________________________________________
consensus GCCTCTTTACATATGAATCGTAAATTCGTAATGGAGCAATGCATGCTTCGGGAGATGAAA
 
. : . : . : . : . : . :
rJMSF051B08+ TACCAATTGTCAACTGATCAATAGCTGTAAATGTGTTGTTGTGCACTTAAACAAACGGAC
rJMFF010D17+ TACCAATTGTCAACTGATCAATAGCTGTAAATGTGTTGTTGTGCACTTAAACAAACGGAC
rJMFF022H09+ TACCAATTGTCAACTGATCAATAGCTGTAAATGTGTTGTTGTGCACTTAAACAAACGGAC
rJMFF009C01+ TACCAATTGTCAACTGATCAATAGCTGTAAATGTGTTGTTGTGCACTTAAACAAACGGAC
                      ____________________________________________________________
consensus TACCAATTGTCAACTGATCAATAGCTGTAAATGTGTTGTTGTGCACTTAAACAAACGGAC
 
. : . : . : . : . : . :
rJMSF051B08+ AACAGGCATATGCTTTATGGATGCTGAGAATGCTTAATGATTTATGTTGTAAGAGCTTTG
rJMFF010D17+ AACAGGCATATGCTTTATGGATGCTGAGAATGCTTAATGATTTATGTTGTAAGAGCTTTG
rJMFF022H09+ AACAGGCATATGCTTTATGGATGCTGAGAATGCTTAATGATTTATGTTGTAAGAGCTTTG
rJMFF009C01+ AACAGGCATATGCTTTATGGATGCTGAGAATGCTTAATGATTTATGTTGTAAGAGCTTTG
                      ____________________________________________________________
consensus AACAGGCATATGCTTTATGGATGCTGAGAATGCTTAATGATTTATGTTGTAAGAGCTTTG
 
. : . : . : . : . : . :
rJMSF051B08+ TGCCTTTGACATCGTCGTGGTCTACTTAGTTTCCTCTGTGAATATTGTAGGTTATGCTAT
rJMFF010D17+ TGCCTTTGACATCGTCGTGGTCTACTTAGTTTCCTCTGTGAATATTGTAGGTTATGCTAT
rJMFF022H09+ TGCCTTTGACATCGTCGTGGTCTACTTAGTTTCCTCTGTGAATATTGTAGGTTATGCTAT
rJMFF009C01+ TGCCTTTGACATCGTCGTGGTCTACTTAGTTTCCTCTGTGAATATTGTAGGTTATGCTAT
                      ____________________________________________________________
consensus TGCCTTTGACATCGTCGTGGTCTACTTAGTTTCCTCTGTGAATATTGTAGGTTATGCTAT
 
. : . : . : . : . : . :
rJMSF051B08+ GCTTATGTGATGTACTTTCAAGGTTAATCGAGCAATGAATTGTGTATTTCGCTCGTATCT
rJMFF010D17+ GCTTATGTGATGTACTTTCAAGGTTAATCGAGCAATGAATTGTGTATTTCGCTCGTATCT
rJMFF022H09+ GCTTATGTGATGTACTTTCAAGGTTAATCGAGCAATGAATTGTGTATTTCGCTCGTATCT
rJMFF009C01+ GCTTATGTGATGTACTTTCAAGGTTAATCGAGCAATGAATTGTGTATTTCGCTCGTATCT
                      ____________________________________________________________
consensus GCTTATGTGATGTACTTTCAAGGTTAATCGAGCAATGAATTGTGTATTTCGCTCGTATCT
 
. : . : . : . : . : . :
rJMSF051B08+ GA
rJMFF010D17+ GAAT
rJMFF022H09+ GAGTTATTAATGTGTT
rJMFF009C01+ GAATTATTAATGTGTTACTTTTCTGAACAAATTTGCCTGGTTCTTCAACCTCCTCGTGTC
                      ____________________________________________________________
consensus GAATTATTAATGTGTTACTTTTCTGAACAAATTTGCCTGGTTCTTCAACCTCCTCGTGTC
 
. : . : . : . : . : . :
rJMFF009C01+ TTTAACATACTGTGCTGCAACTTGTGCTTATGGTCTGTCTTGGTTTTTGGGGCACGATTC
                      ____________________________________________________________
consensus TTTAACATACTGTGCTGCAACTTGTGCTTATGGTCTGTCTTGGTTTTTGGGGCACGATTC