Previous Contig 008584:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009A19Sequence637008584 (7)gb:AF118113_17695942e-33Lycopersicon esculentum MFP1 attachment factor 1 (MAF1) mRNA, complete cds.
JMFF039J07Sequence460008584 (7)gb:AF118113_17695941e-31Lycopersicon esculentum MFP1 attachment factor 1 (MAF1) mRNA, complete cds.726008584 (7)gb:AF118113_17695942e-33Lycopersicon esculentum MFP1 attachment factor 1 (MAF1) mRNA, complete cds.
JMFN007D22Sequence607008584 (7)gb:AF118113_17695941e-33Lycopersicon esculentum MFP1 attachment factor 1 (MAF1) mRNA, complete cds.
JMFN025N04Sequence527008584 (7)gb:AF118113_17695947e-12Lycopersicon esculentum MFP1 attachment factor 1 (MAF1) mRNA, complete cds.
JMSF006O11Sequence278008584 (7)gb:AF118113_17695945e-18Lycopersicon esculentum MFP1 attachment factor 1 (MAF1) mRNA, complete cds.161008584 (7)gb:AF118113_17695940.003Lycopersicon esculentum MFP1 attachment factor 1 (MAF1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039J07- AAGGAAACATTGAAGC
                      ____________________________________________________________
consensus AAGGAAACATTGAAGC
 
. : . : . : . : . : . :
JMFN025N04+ AAGATCTAATAGTATGAGCATTGTATAAAAGATCTTA
rJMFF039J07- TAATTACTGAAACAACATATAATAAGATCTAATAGTATGAGCATTGTATAAAAGATCTTA
rJMFF009A19- AAGATCTAATAGTATGAGCATTGTATAAAAGATCTTA
                      ____________________________________________________________
consensus TAATTACTGAAACAACATATAATAAGATCTAATAGTATGAGCATTGTATAAAAGATCTTA
 
. : . : . : . : . : . :
JMFN025N04+ AAACCACATAGACAGCAGAATTAGATCTCAATCAATTCTCAACATCGGCCAAGGAGCAGT
rJMFF039J07- AAACCACATAGACAGCAGAATTAGACCTCAATCAATTCTCAACATCGGCCAAGGAGCAGT
JMFN007D22+ AGCAGAATTAGATCTCAATCAATTCTCAACATCGGCCAAGGAGCAGT
rJMFF009A19- AAACCACATAGACAGCAGAATTAGATCTCAATCAATTCTGAACATCGGCCAAGGAGCAGT
                      ____________________________________________________________
consensus AAACCACATAGACAGCAGAATTAGATCTCAATCAATTCTCAACATCGGCCAAGGAGCAGT
 
. : . : . : . : . : . :
JMFN025N04+ TCAATTAACCGAAACCCTAGTATTTCAATTTTCAACTGCAAATATAGTAAAAGAACACTA
rJMFF039J07- TCAATTAACCGAAACCCTAGTATTTCAATTTTCAACTGCAAATATAGTAAAAGAACACTA
JMFN007D22+ TCAATTAACCGAAACCCTAGTATTTCAATTTTCAACTGCAAATATAGTAAAAGAACACTA
rJMFF009A19- TCAATTAACCGAAACCCTAGTATTTCAATTTTCAACTGCAAATATAGTAAAAGAACACTA
                      ____________________________________________________________
consensus TCAATTAACCGAAACCCTAGTATTTCAATTTTCAACTGCAAATATAGTAAAAGAACACTA
 
. : . : . : . : . : . :
JMFN025N04+ GAAAACCTCAATGCACATTTCACGGCTCCGTCTTAACATCCGAGACTTCCTCACCGGGAA
rJMFF039J07- GAAAACCTCAATGCACATTTCACGGCTCCGTCTTAACATCCGAGACTTCCTCACCGGGAA
rJMSF006O11- CGAGACTTCCTCACCGGGAA
JMFN007D22+ GAAAACCTCAATGCACATTTCACGGCTCCGTCTTAACATCCGAGACTTCCTCACCGGGAA
JMFF039J07+ GGAA
rJMFF009A19- GAAAACCTCAATGCACATTTCACGGCTCCGTCTTAACATCCGAGACTTCCTCACCGGGAA
                      ____________________________________________________________
consensus GAAAACCTCAATGCACATTTCACGGCTCCGTCTTAACATCCGAGACTTCCTCACCGGGAA
 
. : . : . : . : . : . :
JMFN025N04+ CAGAGCCAACAGCGGCCTCCTCACCCTCCACAGACGGCTTACCCTCCGGCGCGGCGGCGG
rJMFF039J07- CAGAGCCAACAGCGGCCTCCTCACCCTCCACAGACGGCTTACCCTCCGGCGCGGCGGCGG
rJMSF006O11- CANAGCCNACAGCGGCCTCCTCANCCTCNACAGACGGGTTANNCTCNGGCGCGGCGGCGG
JMFN007D22+ CAGAGCCAACAGCGGCCTCCTCACCCTCCACAGACGGCTTACCCTCCGGCGCGGCGGCGG
JMFF039J07+ CAGAGCCAACAGCGGCCTCCTCACCCTCCACAGACGGCTTACCCTCCGGCGCGGCGGCGG
rJMFF009A19- CAGAGCCAACAGCGGCCTCCTCACCCTCCACAGACGGCTTACCCTCCGGCGCGGCGGCGG
                      ____________________________________________________________
consensus CAGAGCCAACAGCGGCCTCCTCACCCTCCACAGACGGCTTACCCTCCGGCGCGGCGGCGG
 
. : . : . : . : . : . :
JMFN025N04+ CAGATCTGGACTTGACGGTGTCGAGCATGCGCTTACTGATCTCCTTGGAATAAAGCTGGA
rJMFF039J07- CAGATCTGGACTTGACGGTGTCGAGCATGCGCTTACTGATCTCCTTGGAATAAAGCTGGA
rJMSF006O11- CAGATCTGGACTTGACGGTGTCGAGGATGCGCTTACTGATCTNCTTGGANTAAAGCTGGA
JMFN007D22+ CAGATCTGGACTTGACGGTGTCGAGCATGCGCTTACTGATCTCCTTGGAATAAAGCTGGA
JMFF039J07+ CAGATCTGGACTTGACGGTGTCGAGCATGCGCTTACTGATCTCCTTGGAATAAAGCTGGA
rJMFF009A19- CAGATCTGGACTTGACGGTGTCGAGCATGCGCTTACTGATCTCCTTGGAATAAAGCTGGA
                      ____________________________________________________________
consensus CAGATCTGGACTTGACGGTGTCGAGCATGCGCTTACTGATCTCCTTGGAATAAAGCTGGA
 
. : . : . : . : . : . :
JMFN025N04+ GGATCTCGATGCCGTCGTCGTCGGCAGAGGCAGACGCCGCGGCGAAGTTATACGCCTCCT
rJMFF039J07- GGATCTCGATGCCGTCGTCGTCGGCAGAGGCAGACGCCGCGGCGAAGTTATACGCCTCCT
rJMSF006O11- CGATCGCGATGCCGTCGT
JMFN007D22+ GGATCTCGATGCCGTCGTCGTCGGCAGAGGCAGACGCCGCGGCGAAGTTATACGCCTCCT
JMFF039J07+ GGATCTCGATGCCGTCGTCGTCGGCAGAGGCAGACGCCGCGGCGAAGTTATACGCCTCCT
JMSF006O11+ GTCGTCGTCGGCAGAGGCAGACGCCGCGGCGAAGTTATACGCCTCCT
rJMFF009A19- GGATCTCGATGCCGTCGTCGTCGGCAGAGGCAGACGCCGCGGCGAAGTTATACGCCTCCT
                      ____________________________________________________________
consensus GGATCTCGATGCCGTCGTCGTCGGCAGAGGCAGACGCCGCGGCGAAGTTATACGCCTCCT
 
. : . : . : . : . : . :
JMFN025N04+ CCTCAATCTGCTTGGCGACATCGGAG
rJMFF039J07- CCTCAATCTGCTTGGCGACCTCGGAGGCCTCCTCCTGGGAAATGGTGCCGTAACGCTTGG
JMFN007D22+ CCTCAATCTGCTTGGCGACCTCGGAGGCCTCCTCCTGGGAAATGGTGCCGTAACGCTTGG
JMFF039J07+ CCTCAATCTGCTTGGCGACCTCGGAGGCCTCCTCCTGGGAAATGGTGCCGTAACGCTTGG
JMSF006O11+ CCTCAATCTGCTTGGCGACCTCGGAGGCCTCCTCCTGGGAAATGGTGCCGTAACGCTTGG
rJMFF009A19- CCTCAATCTGCTTGGCGACCTCGGAGGCCTCCTCCTGGGAAATGGTGCCGTAACGCTTGG
                      ____________________________________________________________
consensus CCTCAATCTGCTTGGCGACCTCGGAGGCCTCCTCCTGGGAAATGGTGCCGTAACGCTTGG
 
. : . : . : . : . : . :
rJMFF039J07- ACAAGATGGACGGCGAGGCGAGCGTCTCGATGAGGCGGTTGATAACGGCGTCGCGAGTCT
JMFN007D22+ ACAAGATGGACGGCGAGGCGAGCGTCTCGATGAGGCGGTTGATAACGGCGTCGCGAGTCT
JMFF039J07+ ACAAGATGGACGGCGAGGCGAGCGTCTCGATGAGGCGGTTGATAACGGCGTCGCGAGTCT
JMSF006O11+ ACAAGATGGACGGCGAGGCGAGCGTCTCGATGAGGCGGTTGATAACGGCGTCGCGAGTCT
rJMFF009A19- ACAAGATGGACGGCGAGGCGAGCGTCTCGATGAGGCGGTTGATAACGGCGTCGCGAGTCT
                      ____________________________________________________________
consensus ACAAGATGGACGGCGAGGCGAGCGTCTCGATGAGGCGGTTGATAACGGCGTCGCGAGTCT
 
. : . : . : . : . : . :
rJMFF039J07- TCTGAGTCGGCGGCCAGATGCTGAAGGAG
JMFN007D22+ TCTGAGTCGGCGGCCAGATGCTGAAGGAG
JMFF039J07+ TCTGAGTCGGCGGCCAGATGCTGAAGGAG
JMSF006O11+ TCTGAGTCGGCGGCCAGATGCTGAAGGAGGCCTCCACGGCCATGGGCTTCTTCGGAGCTT
rJMFF009A19- TCTGAGTCGGCGGCCAGATGCTGAAGGAGGCCTCCACGGCCATGGGCTTCTTCGGAGCTT
                      ____________________________________________________________
consensus TCTGAGTCGGCGGCCAGATGCTGAAGGAGGCCTCCACGGCCATGGGCTTCTTCGGAGCTT
 
. : . : . : . : . : . :
JMSF006O11+ CCGAAGCGGCGGCAGTCTCCAGAGCTGATTCGACTTCGGACATGTTCGTC
rJMFF009A19- CCGAAGCGGCGGCAGTCTCCAGAGCTGATTCGACTTCGGACATGTTCGTCAAAGCTTCTT
                      ____________________________________________________________
consensus CCGAAGCGGCGGCAGTCTCCAGAGCTGATTCGACTTCGGACATGTTCGTCAAAGCTTCTT