Previous Contig 008582:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008O03Sequence623000891 (4)pir|T48066|T480662e-22hypothetical protein F26K9.200 - Arabidopsis thaliana>gb:ATF26K9_1550124 Arabido708008582 (6)gb:AY039545_15602581e-36Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532
JMFF017G08Sequence539000891 (4)gb:AY039545_15602586e-14Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532754008582 (6)gb:AY039545_15602581e-76Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532
JMFF026J17Sequence548000891 (4)gb:AY039545_15602586e-19Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532766008582 (6)gb:AY039545_1560258e-103Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532
JMSF023G11Sequence627008582 (6)gb:AY039545_15602581e-39Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532724012358 (3)gb:AY039545_15602581e-68Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532
JMSF024G11Sequence141008582 (6)357012358 (3)gb:AY039545_15602589e-34Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532
JMSF042M08Sequence702008582 (6)gb:AY039545_15602583e-44Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532736012358 (3)gb:AY039545_15602581e-68Arabidopsis thaliana AT3g62770/F26K9_200 mRNA, complete cds.>gb:AY059169_1564532

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024G11- GGTTGCCACTTGCCAGTTGNCACCGNCGCCACGNAATTC
JMSF023G11- GGTTGCCACTTGCCAGTTGCCACCGCCGCCACGCAATTC
JMSF042M08- GGTTGCCACTTGCCAGTTGCCACCGCCGCCACGCAATTC
                      ____________________________________________________________
consensus GGTTGCCACTTGCCAGTTGCCACCGCCGCCACGCAATTC
 
. : . : . : . : . : . :
JMSF024G11- CTCCATCGCCACCCCCATGANCTCTACTCTTCCTTCTTCTTCCCCCTGGCCTCCCCTTAA
JMSF023G11- CTCCATCGCCACCCCCATGACCTCTACTCTTCCTTCTTCTTCCCCCTGGCCTCCCCTTAA
JMSF042M08- CTCCATCGCCACCCCCATGACCTCTACTCTTCCTTCTTCTTCCCCCTGGCCTCCCCTTAA
                      ____________________________________________________________
consensus CTCCATCGCCACCCCCATGACCTCTACTCTTCCTTCTTCTTCCCCCTGGCCTCCCCTTAA
 
. : . : . : . : . : . :
JMSF024G11- NCCTACATCTCCCCCATTCATGGNTGACAATTCTGCTC
JMSF023G11- CCCTACATCTCCCCCATTCATGGCTGACAATTCTGCTCCCGACGCCGACGACCGCTCCCC
JMSF042M08- CCCTACATCTCCCCCATTCATGGCTGACAATTCTGCTCCCGACGCCGACGACCGCTCCCC
                      ____________________________________________________________
consensus CCCTACATCTCCCCCATTCATGGCTGACAATTCTGCTCCCGACGCCGACGACCGCTCCCC
 
. : . : . : . : . : . :
JMSF023G11- GCTCTCCGACCTCTCCGATATCTCATCCGCCGTCACGTCCGCAGCCGCCGCCGCCGCCGC
JMSF042M08- GCTCTCCGACCTCTCCGATATCTCATCCGCCGTCACGTCCGCAGCCGCCGCCGCCGCCGC
                      ____________________________________________________________
consensus GCTCTCCGACCTCTCCGATATCTCATCCGCCGTCACGTCCGCAGCCGCCGCCGCCGCCGC
 
. : . : . : . : . : . :
JMSF023G11- CGCCGACGACGACCGGCGCTCCCAAACCTCACCACCGCTCACCACCGCAACTACACATAA
JMSF042M08- CGCCGACGACGACCGGCGCTCCCAAACCTCACCACCGCTCACCACCGCAACTACACATAA
                      ____________________________________________________________
consensus CGCCGACGACGACCGGCGCTCCCAAACCTCACCACCGCTCACCACCGCAACTACACATAA
 
. : . : . : . : . : . :
JMSF023G11- TTCTAACCCTAACCCTGTTTCTCCACCCGTTGATTCCTTTCCCCCTTCCCTCCTCCACCT
JMSF042M08- TTCTAACCCTAACCCTGTTTCTCCACCCGTTGATTCCTTTCCCCCTTCCCTCCTCCACCT
                      ____________________________________________________________
consensus TTCTAACCCTAACCCTGTTTCTCCACCCGTTGATTCCTTTCCCCCTTCCCTCCTCCACCT
 
. : . : . : . : . : . :
JMSF023G11- CTCCTTTAACCAGGACCACGGCTGCTTTGCTCTCGGGATCAATCGCGGCTTCCGAATCTA
JMSF042M08- CTCCTTTAACCAGGACCACGGCTGCTTTGCTCTCGGGATCAATCGCGGCTTCCGAATCTA
                      ____________________________________________________________
consensus CTCCTTTAACCAGGACCACGGCTGCTTTGCTCTCGGGATCAATCGCGGCTTCCGAATCTA
 
. : . : . : . : . : . :
JMSF023G11- TAACTGCGATCCTTTCCGAGAGATTTTCCGCCGCGACTTCTCTAATACTGGCGGAGGCGG
JMSF042M08- TAACTGCGATCCTTTCCGAGAGATTTTCCGCCGCGACTTCTCTAATACTGGCGGAGGCGG
                      ____________________________________________________________
consensus TAACTGCGATCCTTTCCGAGAGATTTTCCGCCGCGACTTCTCTAATACTGGCGGAGGCGG
 
. : . : . : . : . : . :
JMSF023G11- TGGAATTGGGGTAGTTCAGATGCTCTTCCGATGTAATATCCTAGCCCTAGTCGGTGGAGG
JMSF042M08- TGGAATTGGGGTAGTTCAGATGCTCTTCCGATGTAATATCCTAGCCCTAGTCGGTGGAGG
rJMFF026J17+ GGAGG
                      ____________________________________________________________
consensus TGGAATTGGGGTAGTTCAGATGCTCTTCCGATGTAATATCCTAGCCCTAGTCGGTGGAGG
 
. : . : . : . : . : . :
JMSF023G11- TCCGGAGCCGCAGTATCCTATGAACAAAGTAATGATCTGGGACGATCACCAGTCCAGGTG
JMSF042M08- TCCGGAGCCGCAGTATCCTATGAACAAAGTAATGATCTGGGACGATCACCAGTCCAGGTG
rJMFF026J17+ GCCGGAACCACAGTATCCTTTGAATAAGGTCATGATCTGGGACGATCATCAGTCCAGGTG
                      ____________________________________________________________
consensus TCCGGAGCCGCAGTATCCTATGAACAAAGTAATGATCTGGGACGATCACCAGTCCAGGTG
 
. : . : . : . : . : . :
JMSF023G11- CATCGGCGAGCTATCATTCCGGTCGGAGGTGAAGTCGGTCCGGC
JMSF042M08- CATCGGCGAGCTATCATTCCGGTCGGAGGTGAAGTCGGTCCGGCTCCGGAGGGACCGGAT
rJMFF026J17+ CATCGGAGAGCTATCCTTTCGCTCCGAGGTGAAGTCCGTCCGGCATCGGAGGGATAGAAT
                      ____________________________________________________________
consensus CATCGGCGAGCTATCATTCCGGTCGGAGGTGAAGTCGGTCCGGCTTCGGAGGGATCGGAT
 
. : . : . : . : . : . :
JMSF042M08- TGTGGTCGTTCTGGCGCANAAGATATTCGTATACAATTTCGCGGATTTGAAGCTGTT
rJMFF026J17+ TGTGGTTGTTTTGGCGCAGAAGATATTTGTGTACAATTTCGCAGATTTGAAGTTGTTACA
                      ____________________________________________________________
consensus TGTGGTTGTTTTGGCGCAGAAGATATTTGTGTACAATTTCGCGGATTTGAAGTTGTTACA
 
. : . : . : . : . : . :
rJMFF026J17+ CCAGATAGAGACTATGGTGAACCCGAAAGGATTGTGTGAGGTCTCGCAGGTGTCAGGGTC
                      ____________________________________________________________
consensus CCAGATAGAGACTATGGTGAACCCGAAAGGATTGTGTGAGGTCTCGCAGGTGTCAGGGTC
 
. : . : . : . : . : . :
rJMFF026J17+ TATGGTGCTGGTTTGTCCGGGGCTGCAAAAGGGCCAGGTCAGGGTTGAACACTATGGCTC
rJMFF017G08+ GTCCGGGGCTGCAAAAGGGCCAGGTCAGGGTTGAACACTATGGCTC
                      ____________________________________________________________
consensus TATGGTGCTGGTTTGTCCGGGGCTGCAAAAGGGCCAGGTCAGGGTTGAACACTATGGCTC
 
. : . : . : . : . : . :
rJMFF026J17+ AAAGAGGACAAAATTTATAGCGGCTCACGATTCGAGGGTATCATCTTTTGCTCTAACAAA
rJMFF017G08+ AAAGAGGACAAAATTTATAGCGGCTCACGATTCGAGGGTATCATCTTTTGCTCTAACAAA
                      ____________________________________________________________
consensus AAAGAGGACAAAATTTATAGCGGCTCACGATTCGAGGGTATCATCTTTTGCTCTAACAAA
 
. : . : . : . : . : . :
rJMFF026J17+ CGATGGGAAATTGCTTGCTACAGCAAGTAGTAAAGGGACTCTTGTGAGGGTGTTCAATAC
rJMFF017G08+ CGATGGGAAATTGCTTGCTACAGCAAGTAGTAAAGGGACTCTTGTGAGGGTGTTCAATAC
                      ____________________________________________________________
consensus CGATGGGAAATTGCTTGCTACAGCAAGTAGTAAAGGGACTCTTGTGAGGGTGTTCAATAC
 
. : . : . : . : . : . :
rJMFF026J17+ TTTAGATGGATCATTGCTTCAAGAGCTTAGGAGAGGTGCAGACAGAGCTGAGATTTACAG
rJMFF017G08+ TTTAGATGGATCATTGCTTCAAGAGCTTAGGAGAGGTGCAGACAGAGCTGAGATTTACAG
                      ____________________________________________________________
consensus TTTAGATGGATCATTGCTTCAAGAGCTTAGGAGAGGTGCAGACAGAGCTGAGATTTACAG
 
. : . : . : . : . : . :
rJMFF026J17+ CCTTGCTTTTTCTTCCACTGCCCAATGGCTAGCTGTCTCAAGTGATAAAGGAACTGTACA
rJMFF017G08+ CCTTGCTTTTTCTTCCACTGCCCAATGGCTAGCTGTCTCAAGTGATAAAGGAACTGTACA
rJMFF008O03+ TTCCACTGCCCAATGGCTAGCTGTCTCAAGTGATAAAGGAACTGTACA
                      ____________________________________________________________
consensus CCTTGCTTTTTCTTCCACTGCCCAATGGCTAGCTGTCTCAAGTGATAAAGGAACTGTACA
 
. : . : . : . : . : . :
rJMFF026J17+ TGTTTTCAACCTAAAGGTTGAATCAGGATCTCTAGGGGTTGAGAGATCTCGTGATCCAAC
rJMFF017G08+ TGTTTTCAACCTAAAGGTTGAATCAGGATCTCTAGGGGTTGAGAGATCTCGTGATCCAAC
rJMFF008O03+ TGTTTTCAACNTAAAGGTTGAATCAGGATCTCTAGGGGTTGAGAGATCTCGTGATCCAAC
                      ____________________________________________________________
consensus TGTTTTCAACCTAAAGGTTGAATCAGGATCTCTAGGGGTTGAGAGATCTCGTGATCCAAC
 
. : . : . : . : . : . :
rJMFF026J17+ TGATACAAGTTCAACAACTCCATCAACTGTTTCACATCTCTCCTTCATTAAAGGTGTGCT
rJMFF017G08+ TGATACAAGTTCAACAACTCCATCAACTGTTTCACATCTCTCCTTCATTAAAGGTGTGCT
rJMFF008O03+ TGATACAAGTTCAACAACTCCATCAACTGTTTCACATCTCTCCTTCATTAAAGGTGTGCT
                      ____________________________________________________________
consensus TGATACAAGTTCAACAACTCCATCAACTGTTTCACATCTCTCCTTCATTAAAGGTGTGCT
 
. : . : . : . : . : . :
rJMFF026J17+ GCCAAAATATTTCAGCTCTGAGTGGTCTGTGGCCCAATTTCG-TTGCAAGAAGGTT
rJMFF017G08+ GCCAAAATATTTCAGCTCTGAGTGGTCTGTGGCCCAATTTCGTTTGCAAGAAGGTTTACA
rJMFF008O03+ GCCAAAATATTTCAGCTCTGAGTGGTCTGTGGCCCAATTTCGTTTGCAAGAAGGTTTACA
                      ____________________________________________________________
consensus GCCAAAATATTTCAGCTCTGAGTGGTCTGTGGCCCAATTTCGTTTGCAAGAAGGTTTACA
 
. : . : . : . : . : . :
rJMFF017G08+ GCACATTGTTGCCTTTGGACACCAAAAAAATACAGTTCTTATACTTGGCATGGATGGCAG
rJMFF008O03+ GCACATTGTTGCCTTTGGACACCAAAAAAATACAGTTCTTATACTTGGCATGGATGGCAG
                      ____________________________________________________________
consensus GCACATTGTTGCCTTTGGACACCAAAAAAATACAGTTCTTATACTTGGCATGGATGGCAG
 
. : . : . : . : . : . :
rJMFF017G08+ TTTCTACCGATGCCAGTTCGATCCAGCAGCCGGTGGGGAGATGACCCTCCTTGAACATCA
rJMFF008O03+ TTTCTACCGATGCCAGTTCGATCCAGCAGCCGGTGGGGAGATGACCCTCCTTGAACATCA
                      ____________________________________________________________
consensus TTTCTACCGATGCCAGTTCGATCCAGCAGCCGGTGGGGAGATGACCCTCCTTGAACATCA
 
. : . : . : . : . : . :
rJMFF008O03+ AGATTTCTTGCAACCTGAGGAGAGCTTCTGATCACGAGATTGGAACATAAATATTAGCCA
                      ____________________________________________________________
consensus AGATTTCTTGCAACCTGAGGAGAGCTTCTGATCACGAGATTGGAACATAAATATTAGCCA
 
. : . : . : . : . : . :
rJMFF008O03+ ACAATTTCTACTATTATGACCTGGCTCTGAGATTATATTAATTTATTTACCTTGTGAACG
                      ____________________________________________________________
consensus ACAATTTCTACTATTATGACCTGGCTCTGAGATTATATTAATTTATTTACCTTGTGAACG
 
. : . : . : . : . : . :
rJMFF008O03+ AACATGAACTGTAAATATACAAGTGGTGACATTTGGGTCAGTTTTATCTTAAGATTGGGG
                      ____________________________________________________________
consensus AACATGAACTGTAAATATACAAGTGGTGACATTTGGGTCAGTTTTATCTTAAGATTGGGG
 
. : . : . : . : . : . :
rJMFF008O03+ CTGTATATAAATTATCTTTCTGCAATTAGCCTAATTGCTATAAATGTCTTTGGCAATGCT
                      ____________________________________________________________
consensus CTGTATATAAATTATCTTTCTGCAATTAGCCTAATTGCTATAAATGTCTTTGGCAATGCT
 
. : . : . : . : . : . :
rJMFF008O03+ CTTGAATCAATTTGCTTTCTGTAGCCACTATAATGAGGTTATTCCACTTTTGATTTCTTG
                      ____________________________________________________________
consensus CTTGAATCAATTTGCTTTCTGTAGCCACTATAATGAGGTTATTCCACTTTTGATTTCTTG
 
. : . : . : . : . : . :
rJMFF008O03+ ATTATAGTGGTATTGGAGTATGTGAAGTTTGGTAAATTTTCATGGGCTGTTGGAAAAGTC
                      ____________________________________________________________
consensus ATTATAGTGGTATTGGAGTATGTGAAGTTTGGTAAATTTTCATGGGCTGTTGGAAAAGTC