Previous Contig 008581:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008N16Sequence519000462 (7)707008581 (3)
JMFF026D12Sequence508008581 (3)476008581 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008N16+ GTGGTGGAAGTGGAGCTACTTCAGCAGGACATTTGATGGCTCCAGCT
                      ____________________________________________________________
consensus GTGGTGGAAGTGGAGCTACTTCAGCAGGACATTTGATGGCTCCAGCT
 
. : . : . : . : . : . :
rJMFF026D12+ GACAGGCACTC
JMFF026D12- GACAGGCACTC
rJMFF008N16+ GCAGGGCCTGGAGCTGTTGGGTTCAATCCAGCTGTGGCCCCTGTTCTTGGACAGGCACTC
                      ____________________________________________________________
consensus GCAGGGCCTGGAGCTGTTGGGTTCAATCCAGCTGTGGCCCCTGTTCTTGGACAGGCACTC
 
. : . : . : . : . : . :
rJMFF026D12+ ACTGCATTGCTTACAACACAAGGAGCTGGACTAGGGATTGGTAATCTACTTGGAGGACTT
JMFF026D12- ACTGCATTGCTTACAACACAAGGAGCTGGACTAGGGATTGGTAATCTACTTGGAGGACTT
rJMFF008N16+ ACTGCATTGCTTACAACACAAGGAGCTGGACTAGGGATTGGTAATCTACTTGGAGGACTT
                      ____________________________________________________________
consensus ACTGCATTGCTTACAACACAAGGAGCTGGACTAGGGATTGGTAATCTACTTGGAGGACTT
 
. : . : . : . : . : . :
rJMFF026D12+ CCTGTGAATCCTCATGGGGTTCCACCTGTGGTGAACAATGCACCGGGATATGGGGCTCAG
JMFF026D12- CCTGTGAATCCTCATGGGGTTCCACCTGTGGTGAACAATGCACCGGGATATGGGGCTCAG
rJMFF008N16+ CCTGTGAATCCTCATGGGGTTCCACCTGTGGTGAACAATGCACCGGGATATGGGGCTCAG
                      ____________________________________________________________
consensus CCTGTGAATCCTCATGGGGTTCCACCTGTGGTGAACAATGCACCGGGATATGGGGCTCAG
 
. : . : . : . : . : . :
rJMFF026D12+ AGTGCTGCAGGAGGCTATGCAGGTCATCCAGGAATGCAGGGAGGATATCAGAACCCAGCT
JMFF026D12- AGTGCTGCAGGAGGCTATGCAGGTCATCCAGGAATGCAGGGAGGATATCAGAACCCAGCT
rJMFF008N16+ AGTGCTGCAGGAGGCTATGCAGGTCATCCAGGAATGCAGGGAGGATATCAGAACCCAGCT
                      ____________________________________________________________
consensus AGTGCTGCAGGAGGCTATGCAGGTCATCCAGGAATGCAGGGAGGATATCAGAACCCAGCT
 
. : . : . : . : . : . :
rJMFF026D12+ ATGGGGCAGGGAGGAGTGAGGCCGCAAGGTGGTGCCCATTGGCGTGGTCATTAGGCCTGG
JMFF026D12- ATGGGGCAGGGAGGAGTGAGGCCGCAAGGTGGTGCCCATTGGCGTGGTCATTAGGCCTGG
rJMFF008N16+ ATGGGGCAGGGAGGAGTGAGGCCGCAAGGTGGTGCCCATTGGCGTGGTCATTAGGCCTGG
                      ____________________________________________________________
consensus ATGGGGCAGGGAGGAGTGAGGCCGCAAGGTGGTGCCCATTGGCGTGGTCATTAGGCCTGG
 
. : . : . : . : . : . :
rJMFF026D12+ CAGAAGATT
JMFF026D12- CAGAAGATT
rJMFF008N16+ CAGAAGATTATGTTAACATGGTAAACCGCTTTAAGCTACCAGGCCGACTTCAGAAGCTCA
                      ____________________________________________________________
consensus CAGAAGATTATGTTAACATGGTAAACCGCTTTAAGCTACCAGGCCGACTTCAGAAGCTCA
 
. : . : . : . : . : . :
rJMFF008N16+ ATGAGATTAAAAACATGGTGCTATACTGCTATGGATTACTTTATATCTAGACGGAACTTG
                      ____________________________________________________________
consensus ATGAGATTAAAAACATGGTGCTATACTGCTATGGATTACTTTATATCTAGACGGAACTTG
 
. : . : . : . : . : . :
rJMFF008N16+ GAAAGGTTGTGCCCAAAACTAGTTTTCATTCCTTTTGGAGTCGAATAGATGTAATATTGC
                      ____________________________________________________________
consensus GAAAGGTTGTGCCCAAAACTAGTTTTCATTCCTTTTGGAGTCGAATAGATGTAATATTGC
 
. : . : . : . : . : . :
rJMFF008N16+ TTAATGCTTAATGGATTGGAAGGAGGTCATTGTCCTGAAGAAGTTGAAACACAATATGTT
                      ____________________________________________________________
consensus TTAATGCTTAATGGATTGGAAGGAGGTCATTGTCCTGAAGAAGTTGAAACACAATATGTT
 
. : . : . : . : . : . :
rJMFF008N16+ CCTTAGGGATGAAAGTTTTCCATTTAGCTTACATAGTAACATATACTTGTTTTTAAAAGT
                      ____________________________________________________________
consensus CCTTAGGGATGAAAGTTTTCCATTTAGCTTACATAGTAACATATACTTGTTTTTAAAAGT
 
. : . : . : . : . : . :
rJMFF008N16+ TTTCTATTGGAATTTGTAGTAATCTCTCCACTAGCTTTTGTATGCATTTAGAAGTTTGCT
                      ____________________________________________________________
consensus TTTCTATTGGAATTTGTAGTAATCTCTCCACTAGCTTTTGTATGCATTTAGAAGTTTGCT