Previous Contig 008570:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008L05Sequence605000451 (7)gb:AF181683_17748612e-41Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.718008570 (11)gb:AK175297_18172854e-53Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF011C14Sequence581008570 (11)gb:AK175297_18172852e-64Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.689008570 (11)gb:AK175297_18172851e-64Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF015J14Sequence537000451 (7)gb:AF181683_17748617e-73Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.682008570 (11)gb:AK175297_18172856e-64Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF019D10Sequence565000451 (7)gb:AF181683_17748612e-63Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.709008570 (11)gb:AK175297_18172853e-68Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF019K15Sequence572000451 (7)gb:AF181683_17748615e-64Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.765008570 (11)gb:AK175297_18172851e-75Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF030L20Sequence185000451 (7)gb:AF181683_17748613e-08Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.743008570 (11)gb:AK175297_18172854e-73Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF034D23Sequence437000451 (7)gb:AF181683_17748615e-56Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.553008570 (11)gb:AK175297_18172852e-42Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFF040K19Sequence686008570 (11)gb:AK175297_18172851e-64Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMFN035G08Sequence628008570 (11)gb:AK175297_18172854e-85Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.
JMSF044N08Sequence727000451 (7)gb:AF181683_17748615e-85Arabidopsis thaliana RPT2 (RPT2) mRNA, complete cds.721008570 (11)gb:AK175297_18172853e-72Arabidopsis thaliana mRNA, complete cds, clone: RAFL21-73-G18.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN035G08- GCGGCGTTTCCGATCAACTTCCTGT
                      ____________________________________________________________
consensus GCGGCGTTTCCGATCAACTTCCTGT
 
. : . : . : . : . : . :
JMFN035G08- GTTGTCTCCTCAGAACGGCCATCTTCCTCAGAACCGCCACCGGCTGCAAGAACGAGCTGG
                      ____________________________________________________________
consensus GTTGTCTCCTCAGAACGGCCATCTTCCTCAGAACCGCCACCGGCTGCAAGAACGAGCTGG
 
. : . : . : . : . : . :
JMFN035G08- AGAAGAGGATATCGACGATCCTCGAGCACGTGACGGTGGACGACCTTCTGGTGTTGTCGT
                      ____________________________________________________________
consensus AGAAGAGGATATCGACGATCCTCGAGCACGTGACGGTGGACGACCTTCTGGTGTTGTCGT
 
. : . : . : . : . : . :
JMFN035G08- TCACCTTCGACGGCGAGAGGCTGTTCGATTTGGAGAGCGTGCGGAGGATTATCTCCGGGT
                      ____________________________________________________________
consensus TCACCTTCGACGGCGAGAGGCTGTTCGATTTGGAGAGCGTGCGGAGGATTATCTCCGGGT
 
. : . : . : . : . : . :
JMFN035G08- TTGTGGAGAAAGAGAAGAGCGTGGCGGTGTTTAACGGCGGCGACTTTAGAGAAGTTTGCT
JMFF011C14- CGACTTTAGAGAAGTTTGCT
                      ____________________________________________________________
consensus TTGTGGAGAAAGAGAAGAGCGTGGCGGTGTTTAACGGCGGCGACTTTAGAGAAGTTTGCT
 
. : . : . : . : . : . :
JMFN035G08- CGACGGCGATGCAGAGAGTTGGCAAGACCGTCGATGCTTATCTCGGCGAGATTGCCACCC
JMFF011C14- CGACGGCGATGCAGAGAGTTGGCAAGACCGTCGATGCTTATCTCGGCGAGATTGCCACCC
rJMFF030L20+ CGGCGAGATTGCCACCC
rJMFF019K15+ GTCGATGCTTATCTCGGCGAGATTGCCACCC
                      ____________________________________________________________
consensus CGACGGCGATGCAGAGAGTTGGCAAGACCGTCGATGCTTATCTCGGCGAGATTGCCACCC
 
. : . : . : . : . : . :
JMFN035G08- ACGTTGAGCTCAGTATTTCCAAGTTTAATGGAATTGCAAATTTAGTCCCTAAGGGTGCAA
JMFF011C14- ACGTTGAGCTCAGTATTTCCAAGTTTAATGGAATTGCAAATTTAGTCCCTAAGGGTGCAA
rJMFF030L20+ ACGTTGAGCTCAGTATTTCCAAGTTTAATGGAATTGCAAATTTAGTCCNTAAGGGTGCAA
rJMSF044N08+ ACGTTGAGCTCAGTATTTCCAAGTTTAATGGAATTGCAAATTTAGTCCCTAAGGGTGCAA
rJMFF019K15+ ACGTTGAGCTCAGTATTTCCAAGTTTAATGGAATTGCAAATTTAGTCCNTAAGGGTGCAA
rJMFF019D10+ TAATGGAATTGCAAATTTAGTCCNTAAGGGTGCAA
rJMFF015J14+ GGGTGCAA
rJMFF011C14+ CTAAGGGTGCAA
rJMFF040K19+ GGTGCAA
                      ____________________________________________________________
consensus ACGTTGAGCTCAGTATTTCCAAGTTTAATGGAATTGCAAATTTAGTCCCTAAGGGTGCAA
 
. : . : . : . : . : . :
JMFN035G08- GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
JMFF011C14- GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
rJMFF030L20+ GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
rJMSF044N08+ GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
rJMFF019K15+ GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
rJMFF019D10+ GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
rJMFF015J14+ GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
rJMFF011C14+ GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
rJMFF040K19+ GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
                      ____________________________________________________________
consensus GAAAGGTTGATGATGATCTCTACAGAGCTATTGATATCTACTTAAAGGCTCATCCCCAGC
 
. : . : . : . : . : . :
JMFN035G08- TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
JMFF011C14- TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
rJMFF030L20+ TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
rJMSF044N08+ TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
rJMFF019K15+ TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
rJMFF019D10+ TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
rJMFF015J14+ TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
rJMFF011C14+ TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
rJMFF040K19+ TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
rJMFF008L05+ CGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
                      ____________________________________________________________
consensus TCGACGAGATCGAAAGAGAAAAGGTTTGCAGCGTAATGGATCCACTAAAACTCTCATACG
 
. : . : . : . : . : . :
JMFN035G08- AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
JMFF011C14- AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
rJMFF030L20+ AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
rJMSF044N08+ AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
rJMFF019K15+ AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
rJMFF034D23+ AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
rJMFF019D10+ AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
rJMFF015J14+ AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
rJMFF011C14+ AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
rJMFF040K19+ AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
rJMFF008L05+ AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
                      ____________________________________________________________
consensus AAGCTAGGGTTCATGCTTCCCAGAACAAGCGTTTACCAGTGCAGATAGTCCTCCACGCCC
 
. : . : . : . : . : . :
JMFN035G08- TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
JMFF011C14- TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
rJMFF030L20+ TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
rJMSF044N08+ TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
rJMFF019K15+ TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
rJMFF034D23+ TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
rJMFF019D10+ TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
rJMFF015J14+ TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
rJMFF011C14+ TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
rJMFF040K19+ TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
rJMFF008L05+ TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
                      ____________________________________________________________
consensus TATACTACGATCAGCTGAAAATCAGAAGCGGCGCGGAAGATCCAAAGAGCACCCCAAACG
 
. : . : . : . : . : . :
JMFN035G08- CCA
JMFF011C14- CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
rJMFF030L20+ CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
rJMSF044N08+ CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
rJMFF019K15+ CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
rJMFF034D23+ CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
rJMFF019D10+ CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
rJMFF015J14+ CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
rJMFF011C14+ CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
rJMFF040K19+ CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
rJMFF008L05+ CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
                      ____________________________________________________________
consensus CCATTGCAACGAGGAACCAGTTGCAGGCGGACGTAACATTGGTGAAGGAGAACGAAGCTT
 
. : . : . : . : . : . :
JMFF011C14- TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
rJMFF030L20+ TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
rJMSF044N08+ TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
rJMFF019K15+ TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
rJMFF034D23+ TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
rJMFF019D10+ TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
rJMFF015J14+ TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
rJMFF011C14+ TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
rJMFF040K19+ TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
rJMFF008L05+ TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGGGTA
                      ____________________________________________________________
consensus TGCGAACGGAGCTATTGCAGATGAAGATGTTCATAGCCGATATGCAGAATAAGGGGAGTA
 
. : . : . : . : . : . :
JMFF011C14- GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGTAAGCCGACGTTCTTTT
rJMFF030L20+ GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGGAAGCCGACGTTCTTTT
rJMSF044N08+ GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGGAAGCCGACGTTCTTTT
rJMFF019K15+ GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGGAAGCCGACGTTCTTTT
rJMFF034D23+ GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGGAAGCCGACGTTCTTTT
rJMFF019D10+ GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGGAAGCCGACGTTCTTTT
rJMFF015J14+ GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGGAAGCCGACGTTCTTTT
rJMFF011C14+ GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGTAAGCCGACGTTCTTTT
rJMFF040K19+ GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGGAAGCCGACGTTCTTTT
rJMFF008L05+ GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGGAAGCCGACGTTCTTTT
                      ____________________________________________________________
consensus GTCAAGGGAGTTCGGTTAAAGGGAGTAGTGCGAGTGCTGTGAGGAAGCCGACGTTCTTTT
 
. : . : . : . : . : . :
JMFF011C14- CGTCTATGTCTAA
rJMFF030L20+ CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
rJMSF044N08+ CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
rJMFF019K15+ CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
rJMFF034D23+ CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
rJMFF019D10+ CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
rJMFF015J14+ CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
rJMFF011C14+ CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
rJMFF040K19+ CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
rJMFF008L05+ CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
                      ____________________________________________________________
consensus CGTCTATGTCTAAGAAGTTGGGGAAGTTGAATCCTTTCAAGCACGGATCTAAGGACACTT
 
. : . : . : . : . : . :
rJMFF030L20+ CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGGAGATTCTCCATTT
rJMSF044N08+ CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGGAGATTCTCCATTT
rJMFF019K15+ CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGGAGATTCTCCATTT
rJMFF034D23+ CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGGAGATTCTCCATTT
rJMFF019D10+ CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGGAGATTCTCCATTT
rJMFF015J14+ CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGCAGATTCTCCATTT
rJMFF011C14+ CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGGAGATTCTCCATTT
rJMFF040K19+ CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGGAGATTCTCCATTT
rJMFF008L05+ CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGGAGATTCTCCATTT
                      ____________________________________________________________
consensus CGAATTTGGATGATGGTGAGGTGGATATTACCAAGCCTAGGAGAAGGAGATTCTCCATTT
 
. : . : . : . : . : . :
rJMFF030L20+ CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
rJMSF044N08+ CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
rJMFF019K15+ CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
rJMFF034D23+ CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
rJMFF019D10+ CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
rJMFF015J14+ CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
rJMFF011C14+ CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
rJMFF040K19+ CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
rJMFF008L05+ CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
                      ____________________________________________________________
consensus CTTAATTGAAATGTATGTATGGTTAGTTGCTTAGGTTGTGGTGTGTGATTAAGGTTGTGC
 
. : . : . : . : . : . :
rJMFF030L20+ AGA-GGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
rJMSF044N08+ AGACGGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
rJMFF019K15+ AGA-GGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
rJMFF034D23+ AGA-GGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
rJMFF019D10+ AGA-GGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
rJMFF015J14+ AGA-GGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
rJMFF011C14+ AGA-GGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
rJMFF040K19+ AGA-GGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
rJMFF008L05+ AGA-GGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
                      ____________________________________________________________
consensus AGA-GGTTTGTTAGTATTATTTTTTTAATTTGTTGCATTTGGATTGGATTGGATTTTATT
 
. : . : . : . : . : . :
rJMFF030L20+ GTGACAC
rJMSF044N08+ G
rJMFF019K15+ GTGACACTTTTACTA
rJMFF034D23+ GTGACACTTTTACT
rJMFF019D10+ GTGACACTTTTACTA
rJMFF015J14+ GTGACACTTTTACTA
rJMFF011C14+ GTGACACTTTTACTA
rJMFF040K19+ GTGACACTTTTACTA
rJMFF008L05+ GTGACACTTTTACTATTAATTAAATTATTGTTGTTCTCAAAATGTTGAATCTCCAACTCC
                      ____________________________________________________________
consensus GTGACACTTTTACTATTAATTAAATTATTGTTGTTCTCAAAATGTTGAATCTCCAACTCC
 
. : . : . : . : . : . :
rJMFF008L05+ AAAAATTCAATAGAGCATATGAGAGAATGTAAATCTTGGTAACTCAGCTGAATACATATT
                      ____________________________________________________________
consensus AAAAATTCAATAGAGCATATGAGAGAATGTAAATCTTGGTAACTCAGCTGAATACATATT