Previous Contig 008568:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002G21Sequence525007242 (11)pir|E86464|E864641e-26hypothetical protein F12G12.12 [imported] - Arabidopsis thaliana>gb:AE005172_892714008568 (2)pir|C86464|C864642e-54hypothetical protein F12G12.14 [imported] - Arabidopsis thaliana>gb:AE005172_892
JMFF008K20Sequence549007242 (11)pir|E86464|E864647e-31hypothetical protein F12G12.12 [imported] - Arabidopsis thaliana>gb:AE005172_892662008568 (2)gb:AY058162_15642981e-42Arabidopsis thaliana At1g34060/F12G12_150 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF002G21+ CC
                      ____________________________________________________________
consensus CC
 
. : . : . : . : . : . :
rJMFF002G21+ NTGCTGCCGCTGATGAAGATCTTTCCATTTTCACCATCTCCAAGCTCACCGGCCATGCTG
rJMFF008K20+ TG
                      ____________________________________________________________
consensus NTGCTGCCGCTGATGAAGATCTTTCCATTTTCACCATCTCCAAGCTCACCGGCCATGCTG
 
. : . : . : . : . : . :
rJMFF002G21+ GAAGCAGATTCGGGT-GGGCAATTGTAAAAGATAAGAGTGTGTATGAAAACATGTTTATG
rJMFF008K20+ GAAGCAGATTCGGGTGGGGCAATTGTAAAAGATAAGAGTGTGTATGAAAACATGTTTATG
                      ____________________________________________________________
consensus GAAGCAGATTCGGGTGGGGCAATTGTAAAAGATAAGAGTGTGTATGAAAACATGTTTATG
 
. : . : . : . : . : . :
rJMFF002G21+ TATATAAAGGCAGCAGAACTGGGAATTTCAAAGGAGACACAGTTGAGGGCTCTGACTCTC
rJMFF008K20+ TATATAAAGGCAGCAGAACTGGGAATTTCAAAGGAGACACAGTTGAGGGCTCTGACTCTC
                      ____________________________________________________________
consensus TATATAAAGGCAGCAGAACTGGGAATTTCAAAGGAGACACAGTTGAGGGCTCTGACTCTC
 
. : . : . : . : . : . :
rJMFF002G21+ CTGAAAACAGTCCTCCAGGGTGATGGCAGGGGAATCTTCAACTTTTCCTATGAAAAAATG
rJMFF008K20+ CTGAAAACAGTCCTCCAGGGTGATGGCAGGGGAATCTTCAACTTTTCCTATGAAAAAATG
                      ____________________________________________________________
consensus CTGAAAACAGTCCTCCAGGGTGATGGCAGGGGAATCTTCAACTTTTCCTATGAAAAAATG
 
. : . : . : . : . : . :
rJMFF002G21+ AAGAGCAGATGGGAAAAGCTGAGCCAGATCATATCCCAGTCTCATAGATTCACCCTCCAA
rJMFF008K20+ AAGAGCAGATGGGAAAAGCTGAGCCAGATCATATCCCAGTCTCATAGATTCACCCTCCAA
                      ____________________________________________________________
consensus AAGAGCAGATGGGAAAAGCTGAGCCAGATCATATCCCAGTCTCATAGATTCACCCTCCAA
 
. : . : . : . : . : . :
rJMFF002G21+ GAAATCTCTCCAAAGTACTGCAATTTTTTCGAGAAAATTCGAGGACCCTCTCCAGCGTAT
rJMFF008K20+ GAAATCTCTCCAAAGTACTGCAATTTTTTCGAGAAAATTCGAGGACCCTCTCCAGCGTAT
                      ____________________________________________________________
consensus GAAATCTCTCCAAAGTACTGCAATTTTTTCGAGAAAATTCGAGGACCCTCTCCAGCGTAT
 
. : . : . : . : . : . :
rJMFF002G21+ GCTTGGGTGAAGTGTTTATGGGAGGAAGAAACAAATTGCACTACAGTCCTGGAAGCGGCG
rJMFF008K20+ GCTTGGGTGAAGTGTTTATGGGAGGAAGAAACAAATTGCACTACAGTCCTGGAAGCGGCG
                      ____________________________________________________________
consensus GCTTGGGTGAAGTGTTTATGGGAGGAAGAAACAAATTGCACTACAGTCCTGGAAGCGGCG
 
. : . : . : . : . : . :
rJMFF002G21+ AAGATCATAGGGCGAGCGGGCAGCATGTTCAGCGCCGAGGATCGTTATGTGCGGCTCAGC
rJMFF008K20+ AAGATCATAGGGCGAGCGGGCAGCATGTTCAGCGCCGAGGATCGTTATGTGCGGCTCAGC
                      ____________________________________________________________
consensus AAGATCATAGGGCGAGCGGGCAGCATGTTCAGCGCCGAGGATCGTTATGTGCGGCTCAGC
 
. : . : . : . : . : . :
rJMFF002G21+ CTCCTCAAGAGAGACGACGATTTCGAACAGTTGCTAGTTCGGTTGAGGGAGCTGGTCGCC
rJMFF008K20+ CTCCTCAAGAGAGACGACGATTTCGAACAGTTGCTAGTTCGGTTGAGGGAGCTGGTCGCC
                      ____________________________________________________________
consensus CTCCTCAAGAGAGACGACGATTTCGAACAGTTGCTAGTTCGGTTGAGGGAGCTGGTCGCC
 
. : . : . : . : . : . :
rJMFF002G21+ ATTGAAGATGGTGCGAAAACCATGTGAATATAACATTATAATAAGTCACAAGGCTATGGT
rJMFF008K20+ ATTGAAGATGGTGCGAAAACCATGTGAATATAACATTATAATAAGTCACAAGGCTATGGT
                      ____________________________________________________________
consensus ATTGAAGATGGTGCGAAAACCATGTGAATATAACATTATAATAAGTCACAAGGCTATGGT
 
. : . : . : . : . : . :
rJMFF002G21+ TATTCATTGCATGCCTTCTTGGAATAATGGTTGTGGGTCATAGAAAAAAATTGTACTTGG
rJMFF008K20+ TATTCATTGCATGCCTTCTTGGAATAATGGTTGTGGGTCATAGAAAAAAATTGTACTTGG
                      ____________________________________________________________
consensus TATTCATTGCATGCCTTCTTGGAATAATGGTTGTGGGTCATAGAAAAAAATTGTACTTGG
 
. : . : . : . : . : . :
rJMFF002G21+ AATTTGGTTTCCAGGTGTGTATTTCATTGACGC
rJMFF008K20+ AATTTGGTTTCCAGGTGTGTATTTCATTGACGCTATTCCAAAAGGTAAATAGTCCACTTG
                      ____________________________________________________________
consensus AATTTGGTTTCCAGGTGTGTATTTCATTGACGCTATTCCAAAAGGTAAATAGTCCACTTG