Previous Contig 008566:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008K07Sequence496014210gb:AC069474_15409091e-21Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence.683008566 (2)gb:OSJN00011_16932375e-07Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022F23, complete seque
JMSF036L09Sequence670019909gb:AC069474_15409093e-31Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence.702008566 (2)gb:OSJN00011_16932374e-13Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022F23, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036L09+ CTT
                      ____________________________________________________________
consensus CTT
 
. : . : . : . : . : . :
rJMSF036L09+ GATGGAACCTCATTCATGTCACGTATCCTCAAGGTTGTGAAGAAAGGCTCGGCTCCTCCA
rJMFF008K07+ TGAAGAAAGGCTCGGCTCNTCCA
                      ____________________________________________________________
consensus GATGGAACCTCATTCATGTCACGTATCCTCAAGGTTGTGAAGAAAGGCTCGGCTCCTCCA
 
. : . : . : . : . : . :
rJMSF036L09+ GAACCAACATCTGTCATGACTTGGCCTCGAGTAGTGAGAGGAGGCCCTTTCGCCACTTCT
rJMFF008K07+ GAACCAACATCTGTCATGACTTGGCCTCGAGTAGTGAGAGGAGGCCCTTTCGCCACTTCT
                      ____________________________________________________________
consensus GAACCAACATCTGTCATGACTTGGCCTCGAGTAGTGAGAGGAGGCCCTTTCGCCACTTCT
 
. : . : . : . : . : . :
rJMSF036L09+ AGGTTTGGCAGGGTTCCTTTTCCCCGAGGCATACCGAGTGTATATAGGGCCCCCCAGCTC
rJMFF008K07+ AGGTTTGGCAGGGTTCCTTTTCCCCGAGGCATACCGAGTGTATATAGGGCCCCCCAGCTC
                      ____________________________________________________________
consensus AGGTTTGGCAGGGTTCCTTTTCCCCGAGGCATACCGAGTGTATATAGGGCCCCCCAGCTC
 
. : . : . : . : . : . :
rJMSF036L09+ CCGATCAAACCTGGTGCAAGGAGCATGCAATGGAAGCGTGATGCTAAGTTAACTTCAACA
rJMFF008K07+ CCGATCAAACCTGGTGCAAGGAGCATGCAATGGAAGCGTGATGCTAAGTTAACTTCAACA
                      ____________________________________________________________
consensus CCGATCAAACCTGGTGCAAGGAGCATGCAATGGAAGCGTGATGCTAAGTTAACTTCAACA
 
. : . : . : . : . : . :
rJMSF036L09+ GAAAATGTTGGTACAGCAAGAGCCTCAAACAATGCCATGTCATCTATGACTGCTCGGAGC
rJMFF008K07+ GAAAATGTTGGTACAGCAAGAGCCTCAAACAATGCCATGTCATCTATGACTGCTCGGAGC
                      ____________________________________________________________
consensus GAAAATGTTGGTACAGCAAGAGCCTCAAACAATGCCATGTCATCTATGACTGCTCGGAGC
 
. : . : . : . : . : . :
rJMSF036L09+ ATGACATATGTTCGGGCTGAACAGAAAACAAATTGAAGTTTTGGAGCTGTAAAAACTATT
rJMFF008K07+ ATGACATATGTTCGGGCTGAACAGAAAACAAATTGAAGTTTTGGAGCTGTAAAAACTATT
                      ____________________________________________________________
consensus ATGACATATGTTCGGGCTGAACAGAAAACAAATTGAAGTTTTGGAGCTGTAAAAACTATT
 
. : . : . : . : . : . :
rJMSF036L09+ CTTTTGATGGCCCTCTAACGTCTAACAACTTGGAAGGATGAACGTGCATGGTAGCGTTGA
rJMFF008K07+ CTTTTGATGGCCCTCTAACGTCTAACAACTTGGAAGGATGAACGTGCATGGTAGCGTTGA
                      ____________________________________________________________
consensus CTTTTGATGGCCCTCTAACGTCTAACAACTTGGAAGGATGAACGTGCATGGTAGCGTTGA
 
. : . : . : . : . : . :
rJMSF036L09+ TTATGTTTTGCTTGATCATACATCAACCAAGCTGGGTGACGGAATAGTGGAAAGAAAGGG
rJMFF008K07+ TTATGTTTTGCTTGATCATACATCAACCAAGCTGGGTGACGGAATAGTGGAAAGAAAGGG
                      ____________________________________________________________
consensus TTATGTTTTGCTTGATCATACATCAACCAAGCTGGGTGACGGAATAGTGGAAAGAAAGGG
 
. : . : . : . : . : . :
rJMSF036L09+ TTTAGTGGATGGTAGTGTTTTGCTTTATTTATCGTTTTATGTTCTCTGTTTCCCTCTACA
rJMFF008K07+ TTTAGTGGATGGTAGTGTTTTGCTTTATTTATCGTTTTATGTTCTCTGTTTCCCTCTACA
                      ____________________________________________________________
consensus TTTAGTGGATGGTAGTGTTTTGCTTTATTTATCGTTTTATGTTCTCTGTTTCCCTCTACA
 
. : . : . : . : . : . :
rJMSF036L09+ AGGAAAAGGCGGGCTGGAAAGTTGCATTTGTTAATGCAAAGGGGATTTAGTTCTTATTTT
rJMFF008K07+ AGGAAAAGGCGGGCTGGAAAGTTGCATTTGTTAATGCAAAGGGGATTTAGTTCTGATTTT
                      ____________________________________________________________
consensus AGGAAAAGGCGGGCTGGAAAGTTGCATTTGTTAATGCAAAGGGGATTTAGTTCTTATTTT
 
. : . : . : . : . : . :
rJMSF036L09+ TTGTTTGTCCTAGAATTGATGGTGAAAAGGAAAAGTAAAAATAAAAGTACAGGGTATTAG
rJMFF008K07+ TTGTTTGTCCTAGAATTGATGGTGAAAAGGAAAAGTAAAAATAAAAGTACAGGGTATTAG
                      ____________________________________________________________
consensus TTGTTTGTCCTAGAATTGATGGTGAAAAGGAAAAGTAAAAATAAAAGTACAGGGTATTAG
 
. : . : . : . : . : . :
rJMSF036L09+ CAAGAAACACTAATATGCAATTCTGCATGAAGTTGCTGT
rJMFF008K07+ CAAGAAACACTAATATGCAATTCTGCATGAAGTTGCTGTGGTAGATGAAATTCTACAACT
                      ____________________________________________________________
consensus CAAGAAACACTAATATGCAATTCTGCATGAAGTTGCTGTGGTAGATGAAATTCTACAACT