Previous Contig 008563:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008J18Sequence566008563 (2)gb:AY088231_15732523e-61Arabidopsis thaliana clone 4578 mRNA, complete sequence.763008563 (2)gb:AY488758_16086112e-63Pisum sativum short-chain dehydrogenase Tic32 mRNA, complete cds; nuclear gene f

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF008J18- GTATAGATGAAGCCACAACGTAGTTCACAGTGTTGAATACGTAGTTTGATTCGTGAT
                      ____________________________________________________________
consensus GTATAGATGAAGCCACAACGTAGTTCACAGTGTTGAATACGTAGTTTGATTCGTGAT
 
. : . : . : . : . : . :
JMFF008J18- CAATTTTCTCAGAAACAAGAAATGTGGATTTTTGGGATAAAAGGGGAATCTGGGTTCTCA
                      ____________________________________________________________
consensus CAATTTTCTCAGAAACAAGAAATGTGGATTTTTGGGATAAAAGGGGAATCTGGGTTCTCA
 
. : . : . : . : . : . :
JMFF008J18- GCTTCATCAACAGCCGAAGAAGTTACCGAAGGGATTGATGGAACTGACCTCATTGCCATT
                      ____________________________________________________________
consensus GCTTCATCAACAGCCGAAGAAGTTACCGAAGGGATTGATGGAACTGACCTCATTGCCATT
 
. : . : . : . : . : . :
JMFF008J18- GTTACAGGAGCCTCGAGCGGCATTGGAGCAGAGACTGCCCGTGTCCTAGCCTTGCGTGGC
                      ____________________________________________________________
consensus GTTACAGGAGCCTCGAGCGGCATTGGAGCAGAGACTGCCCGTGTCCTAGCCTTGCGTGGC
 
. : . : . : . : . : . :
JMFF008J18- GTACATGTAATTATGGCAGTTCGCAATCTAGAAAGCGGTAGAGCAGTTGCAAGAAGAATA
                      ____________________________________________________________
consensus GTACATGTAATTATGGCAGTTCGCAATCTAGAAAGCGGTAGAGCAGTTGCAAGAAGAATA
 
. : . : . : . : . : . :
JMFF008J18- GTTAAAGAGACTCCTAATGCTAAAGTCAATGTCATGGAATTGGATCTTAGCTCCCTGGCG
                      ____________________________________________________________
consensus GTTAAAGAGACTCCTAATGCTAAAGTCAATGTCATGGAATTGGATCTTAGCTCCCTGGCG
 
. : . : . : . : . : . :
JMFF008J18- TCTGTTAGGAAGTTCGTGTCAGAATATAACGCCTCGGGTTTGCCCTTGAACCTCCTCATT
                      ____________________________________________________________
consensus TCTGTTAGGAAGTTCGTGTCAGAATATAACGCCTCGGGTTTGCCCTTGAACCTCCTCATT
 
. : . : . : . : . : . :
JMFF008J18- AATAATGCAGGGGTTATGGCTACGCCATTCATACTCTCACAAGACAACTTAGAGTTGCAA
rJMFF008J18+ GGCTACGCCATTCATACTCTCACAAGACAACTTAGAGTTGCAA
                      ____________________________________________________________
consensus AATAATGCAGGGGTTATGGCTACGCCATTCATACTCTCACAAGACAACTTAGAGTTGCAA
 
. : . : . : . : . : . :
JMFF008J18- TTTGCAACTAATCACGTTGGTCATTTTCTTTTGACGAATCTATTGTT-GGAAAAGATGAA
rJMFF008J18+ TTTGCAACTAATCACGTTGGTCATTTTCTTTTGACGAATCTATTGTTGGGAAAAGATGAA
                      ____________________________________________________________
consensus TTTGCAACTAATCACGTTGGTCATTTTCTTTTGACGAATCTATTGTTGGGAAAAGATGAA
 
. : . : . : . : . : . :
JMFF008J18- ACGGACAGCTTATGAGTGCCGCAAAGAAGG
rJMFF008J18+ ACGGACAGCTTATGAGTGCCGCAAAGAAGGAAGGATTGTTAATGTTTCATCGAATGCGCA
                      ____________________________________________________________
consensus ACGGACAGCTTATGAGTGCCGCAAAGAAGGAAGGATTGTTAATGTTTCATCGAATGCGCA
 
. : . : . : . : . : . :
rJMFF008J18+ TCAATTACCATACAGTGAAGGAATTCGTTTCAACAAAATTAATGATGAAAAAAGTTATAA
                      ____________________________________________________________
consensus TCAATTACCATACAGTGAAGGAATTCGTTTCAACAAAATTAATGATGAAAAAAGTTATAA
 
. : . : . : . : . : . :
rJMFF008J18+ TAGAATATATGCTTATGGGCAATCGAAGCTCGCCAACATATTGCACGCTACTGAACTTGC
                      ____________________________________________________________
consensus TAGAATATATGCTTATGGGCAATCGAAGCTCGCCAACATATTGCACGCTACTGAACTTGC
 
. : . : . : . : . : . :
rJMFF008J18+ AAGGCGCTTGATGGAAGAACGAGCACGGGTAACTGCAAATTCACTTCATCCTGGAGCAAT
                      ____________________________________________________________
consensus AAGGCGCTTGATGGAAGAACGAGCACGGGTAACTGCAAATTCACTTCATCCTGGAGCAAT
 
. : . : . : . : . : . :
rJMFF008J18+ CGCCACCAATCTTCTGCGTCATAATGGTTTCTTCGATGGGATTGTTAACTGGATTGGGAA
                      ____________________________________________________________
consensus CGCCACCAATCTTCTGCGTCATAATGGTTTCTTCGATGGGATTGTTAACTGGATTGGGAA
 
. : . : . : . : . : . :
rJMFF008J18+ ATACGTCATAAAAAACATCCCACAGGGCGCTGCAACTACGTGCTATGTCGCATTGCATCC
                      ____________________________________________________________
consensus ATACGTCATAAAAAACATCCCACAGGGCGCTGCAACTACGTGCTATGTCGCATTGCATCC
 
. : . : . : . : . : . :
rJMFF008J18+ ACAGGTTGAAGGGCTAAGCGGCGAGTACTTTTGTGACAGCAACATTTCACAGCCGAGCTC
                      ____________________________________________________________
consensus ACAGGTTGAAGGGCTAAGCGGCGAGTACTTTTGTGACAGCAACATTTCACAGCCGAGCTC
 
. : . : . : . : . : . :
rJMFF008J18+ GCTTGCTACCGATGCAGAGTTGGCGAAGAAACTTTGGGATTTCAGCTTGAATCTAACAAG
                      ____________________________________________________________
consensus GCTTGCTACCGATGCAGAGTTGGCGAAGAAACTTTGGGATTTCAGCTTGAATCTAACAAG
 
. : . : . : . : . : . :
rJMFF008J18+ CCAGGAGCCAGTTTGAATGGATTTCATCTTCTTCTCCTCTCTTTATGCTTGCCTGTCTTT
                      ____________________________________________________________
consensus CCAGGAGCCAGTTTGAATGGATTTCATCTTCTTCTCCTCTCTTTATGCTTGCCTGTCTTT
 
. : . : . : . : . : . :
rJMFF008J18+ TACCTTTTTCATTGCTAAGATTTCTGCTTTGGAATGTTGTGTCTGTCTGAAACTAATTGC
                      ____________________________________________________________
consensus TACCTTTTTCATTGCTAAGATTTCTGCTTTGGAATGTTGTGTCTGTCTGAAACTAATTGC
 
. : . : . : . : . : . :
rJMFF008J18+ AGGATGAACTCTCTCTGTAGTGATTAGATTGTCCATCTTCATATCTCTGTTGAAGAAAAT
                      ____________________________________________________________
consensus AGGATGAACTCTCTCTGTAGTGATTAGATTGTCCATCTTCATATCTCTGTTGAAGAAAAT