Previous Contig 008559:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002D20Sequence558008559 (10)gb:AB017067_15134094e-71Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:BT011665_1641245008559 (10)
JMFF008I10Sequence426008559 (10)gb:AP005885_18596562e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P065704008559 (10)gb:AB017067_15134093e-68Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:BT011665_1641
JMSF028D19Sequence674008559 (10)gb:AB017067_15134095e-62Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:BT011665_1641768008559 (10)gb:AB017067_15134092e-71Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:BT011665_1641
JMSF042H23Sequence735008559 (10)gb:AB017067_15134092e-71Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:BT011665_1641714008559 (10)gb:AB017067_15134092e-71Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:BT011665_1641
JMSF044H23Sequence658008559 (10)gb:AB017067_15134094e-69Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:BT011665_1641310008559 (10)gb:AB017067_15134096e-04Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20.>gb:BT011665_1641

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF008I10- ATTCTGCGATTCGCTTTTTCCATTT
JMSF028D19- GATCCGTCTATATACTCGCCTGTCTCTTTCATTCTGCGATTCGCTTTTTCCATTT
                      ____________________________________________________________
consensus GATCCGTCTATATACTCGCCTGTCTCTTTCATTCTGCGATTCGCTTTTTCCATTT
 
. : . : . : . : . : . :
JMFF008I10- TCGTTTACGTTTCACTTTCACTTTTTACTTCTCTCTTTCTTTGTTGAGATTGCGGGTTGG
JMSF028D19- TCGTTTACGTTTCACTTTCACTTTTTACTTCTCTCTTTCTTTGTTGAGATTGCGGGTTGG
                      ____________________________________________________________
consensus TCGTTTACGTTTCACTTTCACTTTTTACTTCTCTCTTTCTTTGTTGAGATTGCGGGTTGG
 
. : . : . : . : . : . :
JMFF008I10- GTTGGGTTGGGTTGGGTTGGGTTGGTAGGTAGAAACGCCCAATCCCTTCCAAATTCCAAG
JMSF028D19- GTTGGGTTGGGTTGGGTTGGGTTGGTAGGTAGAAACGCCCAATCCCTTCCAAATTCCAAG
JMFF002D20- GGGTTGGTAGGTAGAAACGCCCAATCCCTTCCAAATTCCAAG
rJMSF028D19+ TTCCAAATTCCAAG
                      ____________________________________________________________
consensus GTTGGGTTGGGTTGGGTTGGGTTGGTAGGTAGAAACGCCCAATCCCTTCCAAATTCCAAG
 
. : . : . : . : . : . :
JMFF008I10- CAAGGCCTTCAATCGTCGGATCTTCCAGTTCTTGTTGTTTGAATTGGATGGCGAATTTGT
JMSF028D19- CAAGGCCTTCAATCGTCGGATCTTCCAGTTCTTGTTGTTTGAATTGGATGGCGAATTTGT
JMFF002D20- CAAGGCCTTCAATCGTCGGATCTTCCAGTTCTTGTTGTTTGAATTGGATGGCGAATTTGT
JMSF044H23- CAAGGCCTTCAATCGTCGGATCTTCCAGTTCTTGTTGTTTGAATTGGATGGCGAATTTGT
JMSF042H23- CAAGGCCTTCAATCGTCGGATCTTCCAGTTCTTGTTGTTTGAATTGGATGGCGAATTTGT
rJMSF028D19+ CAAGGCCTTCAATCGTCGGATCTTCCAGTTCTTGTTGTTTGAATTGGATGGCGAATTTGT
rJMSF042H23+ GAATTTGT
                      ____________________________________________________________
consensus CAAGGCCTTCAATCGTCGGATCTTCCAGTTCTTGTTGTTTGAATTGGATGGCGAATTTGT
 
. : . : . : . : . : . :
JMFF008I10- ATGTCAGGGCGGCGCCGACGACGGATCTGAATAAAAACACCGAGTGGTTCACGTATCCAG
JMSF028D19- ATGTCAGGGCGGCGCCGACGACGGATCTGAATAAAAACACCGAGTGGTTCACGTATCCAG
JMFF002D20- ATGTCAGGGCGGCGCCGACGACGGATCTGAATAAAAACACCGAGTGGTTCACGTATCCAG
JMSF044H23- ATGTCAGGGCGGCGCCNACGACGGATCTGAATAAAAACACCGAGTGGTTCACGTATCCNG
JMSF042H23- ATGTCAGGGCGGCGCCGACGACGGATCTGAATAAAAACACCGAGTGGTTCACGTATCCAG
rJMSF028D19+ ATGTCAGGGCGGCGCCGACGACGGATCTGAATAAAAACACCGAGTGGTTCACGTATCCAG
rJMSF042H23+ ATGTCAGGGCGGCGCCGACGACGGATCTGAATAAAAACACCGAGTGGTTCACGTATCCAG
rJMFF008I10+ CGACGACGGATCTGAATAAAAACACCGAGTGGTTCACGTATCCAG
                      ____________________________________________________________
consensus ATGTCAGGGCGGCGCCGACGACGGATCTGAATAAAAACACCGAGTGGTTCACGTATCCAG
 
. : . : . : . : . : . :
JMFF008I10- GGGTATGGTCCACCTACATCCTTATCCTCTTCTTCTCGTGGCTCGNTTTTCTCTCCGNCT
JMSF028D19- GGGTATGGTCCACCTACATCCTTATCCTCTTCTTCTCATGGCTCGTTTTTCTCTCCGTCT
JMFF002D20- GGGTATGGTCCACCTACATCCTTATCCTCTTCTTCTCATGGCTCGTTTTTCTCTCCGTCT
JMSF044H23- GGGTATGGTCCACCTACATCCTTATCCTCTTCTTCTCATGGCTCGTTTTTCTCTCCGTCT
JMSF042H23- GGGTATGGTCCACCTACATCCTTATCCTCTTCTTCTCATGGCTCGTTTTTCTCTCCGTCT
rJMSF028D19+ GGGTATGGTCCACCTACATCCTTATCCTCTTCTTCTCATGGCTCGTTTTTCTCTCCGTCT
rJMSF042H23+ GGGTATGGTCCACCTACATCCTTATCCTCTTCTTCTCATGGCTCGTTTTTCTCTCCGTCT
rJMFF008I10+ GGGTATGGTCCACCTACATCCTTATCCTCTTCTTCTCGTGGCTCGTTTTTCTCTCCGTCT
                      ____________________________________________________________
consensus GGGTATGGTCCACCTACATCCTTATCCTCTTCTTCTCATGGCTCGTTTTTCTCTCCGTCT
 
. : . : . : . : . : . :
JMFF008I10- TCGGCTGCTCTCCCGGCACCGCCTGGACAATCGNCAACCTCTCTCATTTCATGATTACAT
JMSF028D19- TCGGCTGCTCTCCCGGCACCGCCTGGACAATCGTCAACCTCTCTCATTTCATGATTACAT
JMFF002D20- TCGGCTGCTCTCCCGGCACCGCCTGGACAATCGTCAACCTCTCTCATTTCATGATTACAT
JMSF044H23- TCGGCTGCTCTCCCGGCACCGCCAGGACNATCGTCAACCTCTCTCATTTCATGATTACAT
JMSF042H23- TCGGCTGCTCTCCCGGCACCGCCTGGACAATCGTCAACCTCTCTCATTTCATGATTACAT
rJMSF028D19+ TCGGCTGCTCTCCCGGCACCGCCTGGACAATCGTCAACCTCTCTCATTTCATGATTACAT
rJMSF042H23+ TCGGCTGCTCTCCCGGCACCGCCTGGACAATCGTCAACCTCTCTCATTTCATGATTACAT
rJMFF008I10+ TCGGCTGCTCTCCCGGCACCGCCTGGACAATCGTCAACCTCTCTCATTTCATGATTACAT
                      ____________________________________________________________
consensus TCGGCTGCTCTCCCGGCACCGCCTGGACAATCGTCAACCTCTCTCATTTCATGATTACAT
 
. : . : . : . : . : . :
JMFF008I10- ATCACTTCTTTCACTGGAAGAAAGGAACACCTTTTGCA
JMSF028D19- ATCACTTCTTTCACTGGAAGAAAGGAACACCTTTTGCAGATGACCAGGGTATTTACAATA
JMFF002D20- ATCACTTCTTTCACTGGAAGAAAGGAACACCTTTTGCAGATGACCAGGGTATTTACAATA
JMSF044H23- ATCACTTCTTTCACTGGAAGAAAGGAACACCTTTTGCANATGACCAGGGTATTTACAATA
JMSF042H23- ATCACTTCTTTCACTGGAAGAAAGGAACACCTTTTGCAGATGACCAGGGTATTTACAATA
rJMSF028D19+ ATCACTTCTTTCACTGGAAGAAAGGAACACCTTTTGCAGATGACCAGGGTATTTACAATA
rJMSF042H23+ ATCACTTCTTTCACTGGAAGAAAGGAACACCTTTTGCAGATGACCAGGGTATTTACAATA
rJMFF008I10+ ATCACTTCTTTCACTGGAAGAAAGGAACACCTTTTGCAGATGACCAGGGTATTTACAATA
                      ____________________________________________________________
consensus ATCACTTCTTTCACTGGAAGAAAGGAACACCTTTTGCAGATGACCAGGGTATTTACAATA
 
. : . : . : . : . : . :
JMSF028D19- GGTTGACTTGGTGGGAACAAATANATAATGGCAAGCAGCTTACACGCAATAGAAAGTTTC
JMFF002D20- GGTTGACTTGGTGGGAACAAATAGATAATGGCAAGCAGCTTACACGCAATAGAAAGTTTC
JMSF044H23- GGTTGACTTGGTGGGAACAAATAGATAATGGCAAGCAGCTTACACGCAATAGAAAGTTTC
JMSF042H23- GGTTGACTTGGTGGGAACAAATAGATAATGGCAAGCAGCTTACACGCAATAGAAAGTTTC
rJMSF028D19+ GGTTGACTTGGTGGGAACAAATAGATAATGGCAAGCAGCTTACACGCAATAGAAAGTTTC
rJMSF042H23+ GGTTGACTTGGTGGGAACAAATAGATAATGGCAAGCAGCTTACACGCAATAGAAAGTTTC
rJMFF008I10+ GGTTGACTTGGTGGGAACAAATAGATAATGGCAAGCAGCTTACACGCAATAGAAAGTTTC
                      ____________________________________________________________
consensus GGTTGACTTGGTGGGAACAAATAGATAATGGCAAGCAGCTTACACGCAATAGAAAGTTTC
 
. : . : . : . : . : . :
JMSF028D19- TGACAGNTGTCCCTGTTGNACTGNATTTAATANCCTCTCACACAACTGATTATCAACACC
JMFF002D20- TGACAGTTGTCCCTGTTGTACTGTATTTAATAGCCTCTCACACAACTGATTATCAACACC
JMSF044H23- TGACAGTTGTCCCTGTTGTACTGTATTTAATAGCCTCTCACACAACTGATTATCAACACC
JMSF042H23- TGACAGTTGTCCCTGTTGTACTGTATTTAATAGCCTCTCACACAACTGATTATCAACACC
rJMSF028D19+ TGACAGTTGTCCCTGTTGTACTGTATTTAATAGCCTCTCACACAACTGATTATCAACACC
rJMSF042H23+ TGACAGTTGTCCCTGTTGTACTGTATTTAATAGCCTCTCACACAACTGATTATCAACACC
rJMFF008I10+ TGACAGTTGTCCCTGTTGTACTGTATTTAATAGCCTCTCACACAACTGATTATCAACACC
                      ____________________________________________________________
consensus TGACAGTTGTCCCTGTTGTACTGTATTTAATAGCCTCTCACACAACTGATTATCAACACC
 
. : . : . : . : . : . :
JMSF028D19- CAATGCTGTTCCTGAACACAGNGGCGGTTTTTANATTGGTTGNTGCCAAGTTTCCTCANA
JMFF002D20- CAATGCTGTTCCTGAACACAGTGGCGGTTTTTATATTGGTTGTTGCCAAGTTTCCTCATA
JMSF044H23- CAATGCTGTTCCTGAACACAGTGGCGGTTTTTATATTGGTTGTTGCCAAGTTTCCTCATA
JMSF042H23- CAATGCTGTTCCTGAACACAGTGGCGGTTTTTATATTGGTTGTTGCCAAGTTTCCTCATA
rJMSF028D19+ CAATGCTGTTCCTGAACACAGTGGCGGTTTTTATATTGGTTGTTGCCAAGTTTCCTCATA
rJMSF042H23+ CAATGCTGTTCCTGAACACAGTGGCGGTTTTTATATTGGTTGTTGCCAAGTTTCCTCATA
rJMSF044H23+ CACAGTGGCGGTTTTNATATTGGTTGNNGCCAAGTTTCCTCATA
rJMFF008I10+ CAATGCTGTTCCTGAACACAGTGGCGGTTTTTATATTGGTTGTTGCCAAGTTTCCTCATA
                      ____________________________________________________________
consensus CAATGCTGTTCCTGAACACAGTGGCGGTTTTTATATTGGTTGTTGCCAAGTTTCCTCATA
 
. : . : . : . : . : . :
JMSF028D19- TGCACAAAGTTCGCATCTT
JMFF002D20- TGCACAAAGTTCGCATCTTCGGGATCAATGCAGAT
JMSF044H23- TGCACAAAGTTCGCATCTTCGGGATCAATGCAGATCAGTGAGAGAGCTGAGTGTTGGTTC
JMSF042H23- TGCACAAAGTTCGCATCTTCGGGATCAATGCAGATCAGTGAGAGAGCTGAGTGTTGGTTC
rJMSF028D19+ TGCACAAAGTTCGCATCTTCGGGATCAATGCAGATCAGTGAGAGAGCTGAGTGTTGGTTC
rJMSF042H23+ TGCACAAAGTTCGCATCTTCGGGATCAATGCAGATCAGTGAGAGAGCTGAGTGTTGGTTC
rJMSF044H23+ NGCACAAAGNTCGCATCTTCGGGATCAATGCAGATCAGTGAGAGAGNTGAGTGTNGGTTC
rJMFF002D20+ GCAGATCAGTGAGAGAGCNGAGTNTTGNTTC
rJMFF008I10+ TGCACAAAGTTCGCATCTTCGGGATCAATGCAGATCAGTGAGAGAGCTGAGTGTTGGTTC
                      ____________________________________________________________
consensus TGCACAAAGTTCGCATCTTCGGGATCAATGCAGATCAGTGAGAGAGCTGAGTGTTGGTTC
 
. : . : . : . : . : . :
JMSF044H23- CACTCACTATAAAGTATGAATCCATTTTGACGTCCTCTCCCGAGTAAATTGAGAATGCCC
JMSF042H23- CACTCACTATAAAGTATGAATCCATTTTGACGTCCTCTCCCGAGTAAATTGAGAATGCCC
rJMSF028D19+ CACTCACTATAAAGTATGAATCCATTTTGACGTCCTCTCCCGAGTAAATTGAGAATGCCC
rJMSF042H23+ CACTCACTATAAAGTATGAATCCATTTTGACGTCCTCTCCCGAGTAAATTGAGAATGCCC
rJMSF044H23+ CACTCACTATAAAGTANGAATCCATTTTGACGTCCTCTCCNGAGTAAATTGAGAATGCCC
rJMFF002D20+ CACTCNNTATAAAGTATGAATCCATNNTGNCGTCNTCTCCCGAGTAAATNGAGAATGCCC
rJMFF008I10+ CACTCACTATAAAGTATGAATCCATTTTGACGTCCTCTCCCGAGTAAATTGAGAATGCCC
                      ____________________________________________________________
consensus CACTCACTATAAAGTATGAATCCATTTTGACGTCCTCTCCCGAGTAAATTGAGAATGCCC
 
. : . : . : . : . : . :
JMSF044H23- CCCGCCCCTGTACAGATGATGCATGTTTGAACTGGAAAGGGTCTCTATATATTGTGTA
JMSF042H23- CCCGCCCCTGTACAGATGATGCATGTTTGAACTGGAAAGGGTCTCTATATATTGTGTAAA
rJMSF028D19+ CCCGCCCCTGTACAGATGATGCATGTTTGAACTGGAAAGGGTCTCTATATATTGTGTAAA
rJMSF042H23+ CCCGCCCCTGTACAGATGATGCATGTTTGAACTGGAAAGGGTCTCTATATATTGTGTAAA
rJMSF044H23+ CCCGCCCCNGTACAGATGCNGCATGTTTGANCTGGAAAGGGTCTCTATATATTGTGTAAA
rJMFF002D20+ CCCGCCCCTGTACNGATGATGCATGTNNGANNNNGAAAGGGTCTCTATATATTGTGTAAN
rJMFF008I10+ CCCGCCCCTGTACAGATGATGCATGTTTGAACTGGAAAGGGTCTCTATATATTGTGTAAA
                      ____________________________________________________________
consensus CCCGCCCCTGTACAGATGATGCATGTTTGAACTGGAAAGGGTCTCTATATATTGTGTAAA
 
. : . : . : . : . : . :
JMSF042H23- AACGAAGGGCTCGATCTCTCTTGTGGGGGATGTTCGTTCGTTCCTTATATGA-ACTGAAC
rJMSF028D19+ AACGAAGGGCTCGATCTCTCTTGTGGGGGATGTTCGTTCGTTCCTTATATGA-ACTGAAC
rJMSF042H23+ AACGAAGGGCTCGATCTCTCTTGTGGGGGATGTTCGTTCGTTCCTTATATGA-ACTGAAC
rJMSF044H23+ AACGNAGGGCTCGATCTCTCTNGTGGGGGATGTTCGTTCGTTCCTNATANGACACTGAAC
rJMFF002D20+ AANGAAGGGCTCGATCTNTGTAGTGGGGGATGTTCGTTNGNTCCTTATATGA-NNTGNAC
rJMFF008I10+ AACGAAGGGCTCGATCTCTCTTGTGGGGGATGTTCGTTCGTTCCTTATATGA-ACTGAAC
                      ____________________________________________________________
consensus AACGAAGGGCTCGATCTCTCTTGTGGGGGATGTTCGTTCGTTCCTTATATGA-ACTGAAC
 
. : . : . : . : . : . :
JMSF042H23- TCATATCTTTGTACCA
rJMSF028D19+ TCATATCTTTGTACCAGCCCCATCTGT
rJMSF042H23+ TCATATCTTTGTACCAGCCCCATCTG-TGAAAAC-TGAAACTCCCAACA
rJMSF044H23+ TCATATCTTNGTACCAGCCCCATCTG
rJMFF002D20+ TCATATCNTCGTACCAGCCCCATCTGT
rJMFF008I10+ TCATATCTTTGTACCAGCCCCATCTGTTGAAAACTTGAAACTCCCAACAATTAAGAAATT
                      ____________________________________________________________
consensus TCATATCTTTGTACCAGCCCCATCTGTTGAAAACTTGAAACTCCCAACAATTAAGAAATT