Previous Contig 008551:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005M07Sequence481008551 (67)gb:AF461048_18018052e-54Cucumis melo aminotransferase 2 mRNA, complete cds.663008551 (67)gb:AY066012_15665851e-84Cucumis melo aminotransferase 1 mRNA, complete cds.
JMFF008H08Sequence594008551 (67)gb:AF461048_18018052e-72Cucumis melo aminotransferase 2 mRNA, complete cds.710008551 (67)gb:AY066012_15665851e-92Cucumis melo aminotransferase 1 mRNA, complete cds.
JMFF022G16Sequence542008551 (67)gb:AF461048_18018059e-65Cucumis melo aminotransferase 2 mRNA, complete cds.756008551 (67)gb:AY066012_1566585e-112Cucumis melo aminotransferase 1 mRNA, complete cds.
JMFF035N14Sequence580008551 (67)gb:AF461048_18018056e-71Cucumis melo aminotransferase 2 mRNA, complete cds.698008551 (67)gb:AY066012_15665856e-94Cucumis melo aminotransferase 1 mRNA, complete cds.
JMFF039A20Sequence592008551 (67)gb:AF461048_18018053e-74Cucumis melo aminotransferase 2 mRNA, complete cds.645008551 (67)gb:AY066012_15665852e-87Cucumis melo aminotransferase 1 mRNA, complete cds.
JMFF040H20Sequence522008551 (67)gb:AF461048_18018058e-63Cucumis melo aminotransferase 2 mRNA, complete cds.758008551 (67)gb:AY066012_1566585e-109Cucumis melo aminotransferase 1 mRNA, complete cds.
JMFF049D17Sequence634008551 (67)gb:AF461048_18018058e-72Cucumis melo aminotransferase 2 mRNA, complete cds.
JMFN029N12Sequence403008551 (67)gb:AF039000_17632986e-43Fritillaria agrestis putative serine-glyoxylate aminotransferase (SGA) mRNA, com
JMSF003D10Sequence302008551 (67)gb:AF461048_18018058e-19Cucumis melo aminotransferase 2 mRNA, complete cds.743008551 (67)gb:AY066012_1566585e-108Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF004E14Sequence416008551 (67)gb:AF461048_18018057e-42Cucumis melo aminotransferase 2 mRNA, complete cds.479008551 (67)gb:AY066012_15665857e-68Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF004E16Sequence279004596 (3)sp|Q94HF1|IF3B_ORYSA7e-18Eukaryotic translation initiation factor 3 subunit 11 (eIF-3 p25) (eIF3k).>gb:AC189008551 (67)gb:AY354208_16018152e-22Cucumis melo Hemed aminotransferase 1 mRNA, complete cds.
JMSF005C09Sequence243004681 (5)126008551 (67)gb:AF039000_17632981e-13Fritillaria agrestis putative serine-glyoxylate aminotransferase (SGA) mRNA, com
JMSF005E11Sequence337008551 (67)gb:AF461048_18018053e-28Cucumis melo aminotransferase 2 mRNA, complete cds.
JMSF006J05Sequence349008551 (67)gb:AF461048_18018053e-28Cucumis melo aminotransferase 2 mRNA, complete cds.554008551 (67)gb:AY066012_15665851e-74Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF007H17Sequence370008551 (67)gb:AF461048_18018054e-32Cucumis melo aminotransferase 2 mRNA, complete cds.785008551 (67)gb:AY066012_1566585e-118Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF008I04Sequence623008551 (67)gb:AY066012_15665853e-84Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF009L22Sequence268008551 (67)gb:AF461048_18018051e-12Cucumis melo aminotransferase 2 mRNA, complete cds.777008551 (67)gb:AY066012_1566585e-118Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF012D18Sequence495008551 (67)gb:AF461048_18018053e-56Cucumis melo aminotransferase 2 mRNA, complete cds.745008551 (67)gb:AY066012_1566585e-108Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF014J11Sequence493008551 (67)gb:AF461048_18018056e-56Cucumis melo aminotransferase 2 mRNA, complete cds.748008551 (67)gb:AY066012_1566585e-113Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF015K16Sequence507008551 (67)gb:AF461048_18018054e-59Cucumis melo aminotransferase 2 mRNA, complete cds.733008551 (67)gb:AY066012_1566585e-112Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF017E15Sequence483008551 (67)gb:AF461048_18018057e-31Cucumis melo aminotransferase 2 mRNA, complete cds.763022760gb:AP003892_18349141e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ13
JMSF019B17Sequence259008551 (67)gb:AF461048_18018051e-10Cucumis melo aminotransferase 2 mRNA, complete cds.748008551 (67)gb:AY066012_1566585e-111Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF021D03Sequence650019196gb:AF461048_18018051e-30Cucumis melo aminotransferase 2 mRNA, complete cds.777008551 (67)gb:AY066012_1566585e-111Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF021L10Sequence675008551 (67)gb:AY354209_16018166e-85Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.750008551 (67)gb:AY066012_1566585e-112Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF022P21Sequence175008551 (67)127008551 (67)
JMSF023L14Sequence671008551 (67)gb:AY354209_16018162e-84Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.746008551 (67)gb:AY066012_1566585e-110Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF026G06Sequence672008551 (67)gb:AY354209_16018167e-84Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.732008551 (67)gb:AY066012_1566585e-110Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF028D24Sequence672008551 (67)gb:AY354209_16018169e-84Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.620008551 (67)gb:AY066012_15665855e-87Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF029F03Sequence561005037 (28)sp|P09043|G3PA_TOBAC3e-63Glyceraldehyde 3-phosphate dehydrogenase A, chloroplast precursor (EC 1.2.1.13) 717008551 (67)gb:AY066012_1566585e-106Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF029L01Sequence674008551 (67)gb:AY354209_16018162e-84Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.691008551 (67)gb:AY066012_1566585e-100Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF030M05Sequence671008551 (67)gb:AY354209_16018162e-84Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.690008551 (67)gb:AY066012_1566585e-100Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF034N04Sequence672008551 (67)gb:AY354209_16018162e-84Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.663008551 (67)gb:AY066012_15665852e-94Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF036F16Sequence410001833 (32)gb:AE016979_3704586e-20Shigella flexneri 2a str. 2457T section 2 of 16 of the complete genome.>gb:AE014658008551 (67)gb:AY066012_15665851e-92Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF036G16Sequence675008551 (67)gb:AY354209_16018166e-85Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.746008551 (67)gb:AY066012_1566585e-110Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF044H15Sequence320008551 (67)gb:AP003892_18349141e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ13
JMSF046M15Sequence722008551 (67)pir|T52250|T522506e-94probable alanine-glyoxylate transaminase (EC 2.6.1.44) [imported] - Arabidopsis 790008551 (67)gb:AY066012_1566585e-112Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF048I06Sequence681008551 (67)gb:AY354209_16018161e-85Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.740008551 (67)gb:AY066012_1566585e-111Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF050P16Sequence629008551 (67)gb:AF461048_18018052e-78Cucumis melo aminotransferase 2 mRNA, complete cds.754008551 (67)gb:AY066012_1566585e-112Cucumis melo aminotransferase 1 mRNA, complete cds.
JMSF051D01Sequence670008551 (67)gb:AY354209_16018168e-85Cucumis melo Hemed aminotransferase 2 mRNA, complete cds.740008551 (67)gb:AY066012_1566585e-110Cucumis melo aminotransferase 1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF003D10- GGGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF007H17- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF017E15- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF006J05- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF009L22- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF019B17- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF004E14- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF014J11- GGGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF012D18- GGGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF015K16- GGGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF034N04- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF036G16- GGGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF030M05- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF023L14- GGGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF029L01- AGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF028D24- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF026G06- GGGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF051D01- GCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF050P16- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMFF049D17- TCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMFF035N14- ATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMFF022G16- ATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMFF008H08- AGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMFF040H20- ATCTTCCCCATTCCCTCTTCAG--TTCACAGATCCAGAGAGAAAGAAC
JMFF039A20- ATCTTCCCCATTCCCTCTTCAG--TTCACAGATCCAGAGAGAAAGAAC
JMSF005E11- ATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMFF005M07- AGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF021L10- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF048I06- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
JMSF046M15- GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
                      ____________________________________________________________
consensus GAGCTTCATCTTCCCCATTCCCTCTTCAGTCTTCACAGATCCAGAGAGAAAGAAC
 
. : . : . : . : . : . :
JMSF003D10- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF007H17- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF017E15- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF006J05- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF009L22- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF019B17- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF004E14- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF014J11- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF012D18- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF015K16- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF034N04- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF036G16- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF030M05- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF023L14- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF029L01- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF028D24- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF026G06- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF051D01- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF050P16- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMFF049D17- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMFF035N14- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMFF022G16- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMFF008H08- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMFF040H20- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMFF039A20- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF005E11- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMFF005M07- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF021L10- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF048I06- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
JMSF046M15- GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
                      ____________________________________________________________
consensus GAAGCCCAGAAGTCGTCCCACCCTGCTATTCTCCACACCAGGGTGTGGGTATTGAGAACA
 
. : . : . : . : . : . :
JMSF003D10- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF007H17- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF017E15- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF006J05- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF009L22- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF019B17- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF004E14- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF014J11- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF012D18- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF015K16- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF034N04- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF036G16- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF030M05- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF023L14- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF029L01- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF028D24- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF026G06- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF051D01- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF050P16- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMFF049D17- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMFF035N14- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMFF022G16- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMFF008H08- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMFF040H20- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMFF039A20- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF005E11- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMFF005M07- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF021L10- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF048I06- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
JMSF046M15- TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
                      ____________________________________________________________
consensus TCAGAATTTCAACTACCTGTGTGATTCAGAGGGGGAAAAGATGGACTACGTAAATGCGCC
 
. : . : . : . : . : . :
JMSF003D10- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF007H17- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF017E15- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF006J05- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF009L22- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF019B17- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF004E14- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF014J11- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF012D18- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF015K16- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF034N04- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF036G16- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF030M05- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF023L14- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF029L01- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF028D24- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF026G06- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF051D01- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF050P16- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMFF049D17- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMFF035N14- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMFF022G16- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMFF008H08- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMFF040H20- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMFF039A20- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF005E11- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMFF005M07- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF021L10- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF048I06- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
JMSF046M15- TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
                      ____________________________________________________________
consensus TGGAAGGAACCATCTTTTTGTTCCGGGACCTGTCAATATCCCGGATCAAGTTATCCGTGC
 
. : . : . : . : . : . :
JMSF003D10- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGTACTGACAAAGACTCT
JMSF007H17- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF017E15- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF006J05- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF009L22- AATGACCAGGAACAATGAGGACTATCGCTCCCC
JMSF019B17- AATGACCAGGAACAATGAGGACTA
JMSF004E14- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF014J11- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF012D18- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF015K16- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF034N04- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF036G16- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF030M05- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF023L14- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF029L01- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF028D24- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF026G06- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF051D01- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF050P16- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMFF049D17- AATGACCAGGAGCAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMFF035N14- AATGACCAGGAGCAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMFF022G16- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMFF008H08- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMFF040H20- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMFF039A20- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF005E11- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMFF005M07- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF021L10- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF048I06- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
JMSF046M15- AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
                      ____________________________________________________________
consensus AATGACCAGGAACAATGAGGACTATCGCTCCCCGGCTGTTCCAGCACTGACAAAGACTCT
 
. : . : . : . : . : . :
JMSF003D10- ACTTGAG
JMSF007H17- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF017E15- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF006J05- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGAT
JMSF004E14- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF014J11- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF012D18- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF015K16- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF034N04- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF036G16- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF030M05- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF023L14- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF029L01- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF028D24- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF026G06- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF051D01- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF050P16- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMFF049D17- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMFF035N14- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMFF022G16- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMFF008H08- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMFF040H20- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMFF039A20- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF005E11- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCC
JMFF005M07- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF021L10- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF048I06- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
JMSF046M15- ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
                      ____________________________________________________________
consensus ACTTGAGGATGTGAAAAAGATTTTCAAGACTACCAGTGGGACTCCATTTCTGATCCCAAC
 
. : . : . : . : . : . :
JMSF007H17- TACAGGGACTGGAGC
JMSF017E15- TACAGG
JMSF004E14- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF014J11- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF012D18- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF015K16- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF034N04- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF036G16- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF030M05- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF023L14- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF029L01- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF028D24- TACAGGGACTGCAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF026G06- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF051D01- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF050P16- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMFF049D17- CACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMFF035N14- CACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMFF022G16- TACAGGGACTGGAGCTTGGGAAAGGGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMFF008H08- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMFF040H20- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMFF039A20- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMFF005M07- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF021L10- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF048I06- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
JMSF046M15- TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
                      ____________________________________________________________
consensus TACAGGGACTGGAGCTTGGGAAAGTGCACTTACCAACACGCTGTCTCCTGGTGATCGGAT
 
. : . : . : . : . : . :
JMSF004E14- C
JMSF014J11- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF012D18- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF015K16- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF034N04- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF036G16- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF030M05- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF023L14- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF029L01- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF028D24- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF026G06- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF051D01- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF050P16- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMFF049D17- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMFF035N14- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMFF022G16- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMFF008H08- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMFF040H20- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMFF039A20- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMFF005M07- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF021L10- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF048I06- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
JMSF046M15- CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
                      ____________________________________________________________
consensus CGTGTCTTTCCTCATTGGTCAGTTCAGTTTGCTCTGGATTGATCAGCAGCAGCGTCTCAA
 
. : . : . : . : . : . :
JMSF014J11- CTTCAATGTTGATGTTGT
JMSF012D18- CTTCAATGTTGATGTTGTGG
JMSF015K16- CTTCAATGTTGATGTTGTGGAGAGTGAATGGG
JMSF034N04- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF036G16- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF030M05- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF023L14- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF029L01- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF028D24- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF026G06- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF051D01- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF050P16- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMFF049D17- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMFF035N14- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMFF022G16- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMFF008H08- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMFF040H20- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTT
JMFF039A20- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMFF005M07- CTTC
JMSF021L10- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF048I06- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
JMSF046M15- CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
                      ____________________________________________________________
consensus CTTCAATGTTGATGTTGTGGAGAGTGAATGGGGGCAAGGTGCAAATCTTGACGTTTTGGC
 
. : . : . : . : . : . :
JMSF034N04- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF036G16- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF030M05- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF023L14- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF029L01- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF028D24- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF026G06- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF051D01- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF050P16- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMFF049D17- TTC-AAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMFF035N14- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTA
JMFF022G16- TTCAAAGCTAGCAG
JMFF008H08- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAA
JMFF039A20- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF021L10- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF048I06- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
JMSF046M15- TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
                      ____________________________________________________________
consensus TTCAAAGCTAGCAGAGGATACAGCGCATACCATCAAGGCTATTTGCATTGTACACAATGA
 
. : . : . : . : . : . :
JMSF034N04- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
JMSF036G16- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
JMSF030M05- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
JMSF023L14- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
JMSF029L01- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
JMSF028D24- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
JMSF026G06- GACTGCAGCTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
JMSF051D01- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAGATTGCTCGATCACTATCA
JMSF050P16- GACTGCAACTGGAGTTACAAACAACTTGGCTACT
JMFF049D17- GACTGCAACTGGAGTTACAAAC-ACTTGGCTACTGTAAG-AAATTGCTCGATC
JMFF039A20- GACTGC
JMSF021L10- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
JMSF048I06- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
JMSF046M15- GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
rJMSF009L22+ CA
rJMSF007H17+ CA
rJMSF046M15+ CA
                      ____________________________________________________________
consensus GACTGCAACTGGAGTTACAAACAACTTGGCTACTGTAAGAAAATTGCTCGATCACTATCA
 
. : . : . : . : . : . :
JMSF034N04- GCATCCAGCTCTCCTCC
JMSF036G16- GCATCCAGCTCTCCTCCTTG
JMSF030M05- GCATCCAGCTCTCCTC
JMSF023L14- GCATCCAGCTCTCCTC
JMSF029L01- GCATCCAGCTCTCCTC
JMSF028D24- GCATCCAGCTCTCCTCC
JMSF026G06- GCATCCAGCTCTCCTCC
JMSF051D01- GCATCCAGCTCTCCT
JMSF021L10- GCATCCAGCTCTCCTCCTTG
JMSF048I06- GCATCCAGCTCTCCTCCTTG
JMSF046M15- GCATCCAGCTCTCCTCCTTGTTGATGGTGTGTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMSF014J11+ ATGGTGTGTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMSF026G06+ TTTGTGCGATTGATTTCCGCAT
rJMSF051D01+ TCCTCCATTTGTGCGATTGATTTCCGCAT
rJMSF009L22+ GCATCCAGCTCTCCTCCTTGTTGATGGTGTGTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMSF021L10+ TGTGTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMSF007H17+ GCATCCAGCTCTCCTCCTTGTTGATGGTGTGTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMSF023L14+ CTCCATTTGTGCGATTGATTTCCGCAT
rJMSF048I06+ ATTTGTGCGATTGATTTCCGCAT
rJMSF015K16+ GTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMFF022G16+ GTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMSF050P16+ TGTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMSF036G16+ TTGTGCGATTGATTTCCGCAT
rJMSF019B17+ TGTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMSF003D10+ CTCCATTTGTGCGATTGA-TTCCGCAT
rJMSF012D18+ GTCCTCCATTTGTGCGATTGA-TTCCGCAT
rJMSF046M15+ GCATCCAGCTCTCCTCCTTGTTGATGGTGTGTCCTCCATTTGTGCGATTGATTTCCGCAT
rJMFF040H20+ CGATTGATTTCCGCAT
rJMSF021D03+ TCCTCCATTTGTGCGATTGATTTCCGCAT
                      ____________________________________________________________
consensus GCATCCAGCTCTCCTCCTTGTTGATGGTGTGTCCTCCATTTGTGCGATTGATTTCCGCAT
 
. : . : . : . : . : . :
JMSF046M15- GGATGAA
rJMSF014J11+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF026G06+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF051D01+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF009L22+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF021L10+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF007H17+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF023L14+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF048I06+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF015K16+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF034N04+ TAC
rJMFF022G16+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF050P16+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF036G16+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF019B17+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF029L01+ TAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF030M05+ AACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF003D10+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF012D18+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF029F03+ GATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF046M15+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMFF040H20+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMSF021D03+ GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
rJMFF035N14+ TAC
                      ____________________________________________________________
consensus GGATGAATGGGGAGTTGATGTGGCATTAACTGGTTCACAGAAAGCTCTGTCTCTTCCTAC
 
. : . : . : . : . : . :
rJMSF014J11+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF026G06+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF051D01+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF009L22+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF021L10+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF007H17+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF023L14+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF048I06+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF015K16+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF034N04+ TGGTATNGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF044H15+ TGGTATTGGAATNGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMFF022G16+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF050P16+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF036G16+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF019B17+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF029L01+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF030M05+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF008I04+ CAAGGCTCTTGAGGCCAGCAAAATTGCAAAATC
rJMSF003D10+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF012D18+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF029F03+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF046M15+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMFF040H20+ TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMSF021D03+ TGGTATTGGAATNGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMFF035N14+ TGGTATNGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCGGCAAAACTGCAAAATC
rJMSF036F16+ GAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
rJMFF005M07+ ACTGCAAAATC
rJMFF039A20+ TGAGGCCAGCAAAACTGCAAAATC
rJMSF028D24+ AGGCCAGCAAAACTGCAAAATC
rJMFF008H08+ GAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
                      ____________________________________________________________
consensus TGGTATTGGAATTGTCTGTGCAAGCCCCAAGGCTCTTGAGGCCAGCAAAACTGCAAAATC
 
. : . : . : . : . : . :
rJMSF014J11+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF026G06+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF051D01+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF009L22+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF021L10+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF007H17+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF023L14+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF048I06+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF015K16+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF034N04+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF044H15+ AGTGAGGGTTTTCTNTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMFF022G16+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF050P16+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF036G16+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF019B17+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF029L01+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF030M05+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF008I04+ AGTGAGGGTTTTNTTTGACTGGANGGNCTNCTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF006J05+ AAGATGGGGACATATTG
rJMSF003D10+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF012D18+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF029F03+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF046M15+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMFF040H20+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF021D03+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMFF035N14+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF036F16+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMFF005M07+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTNTACAAGATGGGGACATATTG
rJMFF039A20+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMSF028D24+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
rJMFF008H08+ AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
                      ____________________________________________________________
consensus AGTGAGGGTTTTCTTTGACTGGAAGGACTACTTGAAGTTCTACAAGATGGGGACATATTG
 
. : . : . : . : . : . :
rJMSF014J11+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF026G06+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF051D01+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF009L22+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF021L10+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF007H17+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF023L14+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF048I06+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF015K16+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF034N04+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF044H15+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGNCCTCGACCTTCTCTT
rJMFF022G16+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF050P16+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF036G16+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF019B17+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF029L01+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF030M05+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF008I04+ GCCATACACTCCTTCCATCCAACTTCTTTATGGNCTGAGAGCAGGCCTCGACCTTCTCTC
rJMSF006J05+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF004E14+ TT
rJMSF003D10+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF012D18+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF029F03+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF046M15+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMFF040H20+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF021D03+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMFF035N14+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF036F16+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMFF005M07+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMFF039A20+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMSF028D24+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
rJMFF008H08+ GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
                      ____________________________________________________________
consensus GCCATACACTCCTTCCATCCAACTTCTTTATGGACTGAGAGCAGGCCTCGACCTTCTCTT
 
. : . : . : . : . : . :
rJMSF014J11+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF026G06+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF051D01+ TGAGTAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF009L22+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF021L10+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF007H17+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF023L14+ TGGGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF048I06+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF015K16+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF034N04+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF044H15+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMFF022G16+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF050P16+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF036G16+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF019B17+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF029L01+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF030M05+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF008I04+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF006J05+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF004E14+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF003D10+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF012D18+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF029F03+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF046M15+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMFF040H20+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF021D03+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMFF035N14+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF036F16+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF004E16+ T
rJMFF005M07+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMFF039A20+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMSF028D24+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
rJMFF008H08+ TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
                      ____________________________________________________________
consensus TGAGGAAGGACTTGATAATGTGATTGCAAGGCACACTCGCCTAGGTACTGCAACAAGGCT
 
. : . : . : . : . : . :
rJMSF014J11+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF026G06+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF051D01+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF009L22+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF021L10+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF007H17+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF023L14+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF048I06+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF015K16+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF034N04+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF044H15+ TGCAGTGCAGGCGTGGGGCNTGAAGANCTGCACCCANAAGGAGGAATGGTTCAGTGNCAC
rJMFF022G16+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF050P16+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF036G16+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF019B17+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF029L01+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF030M05+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF008I04+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF006J05+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF004E14+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF003D10+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF012D18+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF029F03+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF046M15+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMFF040H20+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF021D03+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMFF035N14+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF036F16+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF004E16+ TGCAGNGCAGGCGTGGGGCTTGAAGAACTGCANCCAAAAGGAGGAATGGTTNAGTGACAC
rJMFF005M07+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMFF039A20+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMSF028D24+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
rJMFF008H08+ TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
                      ____________________________________________________________
consensus TGCAGTGCAGGCGTGGGGCTTGAAGAACTGCACCCAAAAGGAGGAATGGTTCAGTGACAC
 
. : . : . : . : . : . :
rJMSF014J11+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF026G06+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF051D01+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF009L22+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF021L10+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF007H17+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF023L14+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF048I06+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF015K16+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF034N04+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF044H15+ AGTCACTGCTGTGGTTGTTC
rJMFF022G16+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF050P16+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF036G16+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF019B17+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF029L01+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF030M05+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF008I04+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF006J05+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF004E14+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF003D10+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF012D18+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF029F03+ AGTCACTGCTGTGGTTGTTCCTTCGTATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF046M15+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMFF040H20+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF021D03+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMFF035N14+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF036F16+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF005C09+ TATTGACAGTTCAGAAATTGTCAAAAGGGCATG
JMFN029N12- CTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF004E16+ AGTCANTGTTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMFF005M07+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMFF039A20+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMSF028D24+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
rJMFF008H08+ AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
                      ____________________________________________________________
consensus AGTCACTGCTGTGGTTGTTCCTTCATATATTGACAGTTCAGAAATTGTCAAAAGGGCATG
 
. : . : . : . : . : . :
rJMSF014J11+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGAAAGGTCTTTAG
rJMSF026G06+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF051D01+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF009L22+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF021L10+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF007H17+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF023L14+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF048I06+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF015K16+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF034N04+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMFF022G16+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF050P16+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF036G16+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF019B17+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF029L01+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF030M05+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF008I04+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF006J05+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF004E14+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF003D10+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF012D18+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF029F03+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF046M15+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTCAG
rJMFF040H20+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF021D03+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMFF035N14+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF036F16+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF005C09+ GAAACGCTACAACTNGAGCTTAGGTNTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
JMFN029N12- GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF004E16+ GAANCGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMFF005M07+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMFF039A20+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMSF028D24+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
rJMFF008H08+ GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
                      ____________________________________________________________
consensus GAAACGCTACAACTTGAGCTTAGGTCTAGGCCTTAACAAAGTGGCAGGGAAGGTCTTTAG
 
. : . : . : . : . : . :
rJMSF014J11+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF026G06+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF051D01+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF009L22+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF021L10+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF007H17+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF023L14+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF048I06+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF015K16+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF034N04+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMFF022G16+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF050P16+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF036G16+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF019B17+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF029L01+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF030M05+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF008I04+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF006J05+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF004E14+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF003D10+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF012D18+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF029F03+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF046M15+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMFF040H20+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF021D03+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMFF035N14+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF036F16+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF005C09+ AATAGGGCACCTTGGTAATNTGAACGAGC
JMFN029N12- AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF004E16+ AATAGGGC
rJMFF005M07+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMFF039A20+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMSF028D24+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
rJMFF008H08+ AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
                      ____________________________________________________________
consensus AATAGGGCACCTTGGTAATCTGAACGAGCTGCAACTACTGGGCTGTCTCGCTGGAGTGGA
 
. : . : . : . : . : . :
rJMSF014J11+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF026G06+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF051D01+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF009L22+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF021L10+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF022P21+ GTTGCAGCAGCTTC
rJMSF007H17+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF023L14+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF048I06+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF015K16+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF034N04+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMFF022G16+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF050P16+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF036G16+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF019B17+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGATTTGCAGCAGCTTC
rJMSF029L01+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF030M05+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF008I04+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF006J05+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF004E14+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF003D10+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF012D18+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF029F03+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF046M15+ GATGGTGCTAAAGG--ATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMFF040H20+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF021D03+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMFF035N14+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF036F16+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
JMSF022P21- GTTGCAGCAGCTTC
JMFN029N12- GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMFF005M07+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMFF039A20+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMSF028D24+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
rJMFF008H08+ GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
                      ____________________________________________________________
consensus GATGGTGCTAAAGGATATCGGTTACCCAGTGAAGCTTGGCAGCGGAGTTGCAGCAGCTTC
 
. : . : . : . : . : . :
rJMSF014J11+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF026G06+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF051D01+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF009L22+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF021L10+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF022P21+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF007H17+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF023L14+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF048I06+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF015K16+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF034N04+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMFF022G16+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF050P16+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF036G16+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF019B17+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF029L01+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF030M05+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF008I04+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF006J05+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF004E14+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF003D10+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF012D18+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF029F03+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF046M15+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMFF040H20+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF021D03+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMFF035N14+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF036F16+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
JMSF022P21- TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
JMFN029N12- TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMFF005M07+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMFF039A20+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMSF028D24+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
rJMFF008H08+ TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
                      ____________________________________________________________
consensus TGCCTACCTGCAAAACACCACTCCCATGATTCCATCCAGAATTTAATTCAAGTGTGTTAT
 
. : . : . : . : . : . :
rJMSF014J11+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTG--AAAAACT
rJMSF026G06+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTG--AAAAACT
rJMSF051D01+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTG--AAAAACT
rJMSF009L22+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTG--AAAAACTAC
rJMSF021L10+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATAC
rJMSF022P21+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTG--AAAAACT
rJMSF007H17+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGTAAAAAACTACATACT
rJMSF023L14+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMSF048I06+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATAC
rJMSF015K16+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTG
rJMSF034N04+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTAC
rJMFF022G16+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMSF050P16+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMSF036G16+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTGT-AAAAACTACATA
rJMSF019B17+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTGT-AAAAACTACATA
rJMSF029L01+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTGT-AAAAACTACATA
rJMSF030M05+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTGT-AAAAACTACATA
rJMSF008I04+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTGT-AAAAA
rJMSF006J05+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTGT-AAAAACTACATA
rJMSF004E14+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTGT-AAAAACTACATA
rJMSF003D10+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTGT-AAAAACTACATA
rJMSF012D18+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTC
rJMSF029F03+ ACTTGCATGTATTTGTTTCTTTCATCTTGTTCCAGGGTACTCTGT-AAAAACTACATAC
rJMSF046M15+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMFF040H20+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMSF021D03+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMFF035N14+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMSF036F16+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
JMSF022P21- ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
JMFN029N12- ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMFF005M07+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMFF039A20+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
rJMSF028D24+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTAC
rJMFF008H08+ ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
                      ____________________________________________________________
consensus ACTTGCATGTATTTGTTTCTTTCATCTTGTT-CAGGGTACTCTGT-AAAAACTACATACT
 
. : . : . : . : . : . :
rJMSF007H17+ T
rJMSF023L14+ T
rJMFF022G16+ TTCTTTAT
rJMSF050P16+ TTCTT
rJMSF046M15+ TTCTTTATGCAC
rJMFF040H20+ TTCTTTATGCACTATT
rJMSF021D03+ TTCTTTATGCACTATTTGAAATAATGCTAT
rJMFF035N14+ TTCTTTATGCACTATTTGAAATAATGCTATTAAACTC
rJMSF036F16+ TTCTTTAT
JMSF022P21- TTCTTTATGCACTATTTGAAATAATGCTATTAAA
JMFN029N12- TTCTTTATGCACTATTTGAAATAATGCTATTAAACTCTGGTTTACTGCAC
rJMFF005M07+ TTCTTTATGCACTATTTGAAATAATGCTATTAAACTCTGGTTTACTGCAC
rJMFF039A20+ TTCTTTATGCACTATT
rJMFF008H08+ TTCTTTATGCACTATTTGAAATAATGCTATTAAACTCTGGTTTACTGCACATATTCATAT
                      ____________________________________________________________
consensus TTCTTTATGCACTATTTGAAATAATGCTATTAAACTCTGGTTTACTGCACATATTCATAT