Previous Contig 008540:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008E15Sequence536008540 (3)gb:AC092852_17357812e-56Oryza sativa chromosome 3 BAC OSJNBa0032G11 genomic sequence, complete sequence.648008540 (3)gb:AC092852_17357813e-56Oryza sativa chromosome 3 BAC OSJNBa0032G11 genomic sequence, complete sequence.
JMSF009F08Sequence364018617sp|Q9SEE4|PIRL_LYCES4e-15Pirin-like protein.>gb:AF154003_1772917 Lycopersicon esculentum pirin mRNA, comp801008540 (3)gb:AC092852_17357812e-77Oryza sativa chromosome 3 BAC OSJNBa0032G11 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009F08+ TGAAATGCCTGTAGGGGAAGGT
                      ____________________________________________________________
consensus TGAAATGCCTGTAGGGGAAGGT
 
. : . : . : . : . : . :
rJMSF009F08+ ACACAAAGGGGTTGCAGCTGTGGATCAATCTTGCCTCCAAGGACAAAATGATTGAGCCAA
                      ____________________________________________________________
consensus ACACAAAGGGGTTGCAGCTGTGGATCAATCTTGCCTCCAAGGACAAAATGATTGAGCCAA
 
. : . : . : . : . : . :
rJMSF009F08+ ATTATCAAGAACTGTTGAGTGCAGACATCCCAAGTGCAGAAAGCGATGGGGTTGAAGTAA
                      ____________________________________________________________
consensus ATTATCAAGAACTGTTGAGTGCAGACATCCCAAGTGCAGAAAGCGATGGGGTTGAAGTAA
 
. : . : . : . : . : . :
JMFF008E15- GAGAGTCGATGGGCTTGAAGTCCCCGGTTTACACAAGAACTCCCACAA
rJMSF009F08+ AGATTATAGCAGGAGAGTCGATGGGCGTGAAGTCCCCGGTTTACACAAGAACTCCCACAA
rJMFF008E15+ GAGAGTCGATGGGCTTGAAGTCCCCGGTTTACACAAGAACTCCCACAA
                      ____________________________________________________________
consensus AGATTATAGCAGGAGAGTCGATGGGCTTGAAGTCCCCGGTTTACACAAGAACTCCCACAA
 
. : . : . : . : . : . :
JMFF008E15- TGTACCTCGATTTCACTCTAAACCCGTCATCTCAACACCACCAAAGCATCCCAGAATCAT
rJMSF009F08+ TGTACCTCGATTTCACTCTAAACCCGTCATCTCAACACCACCAAAGCATCCCAGAATCAT
rJMFF008E15+ TGTACCTCGATTTCACTCTAAACCCGTCATCTCAACACCACCAAAGCATCCCAGAATCAT
                      ____________________________________________________________
consensus TGTACCTCGATTTCACTCTAAACCCGTCATCTCAACACCACCAAAGCATCCCAGAATCAT
 
. : . : . : . : . : . :
JMFF008E15- GGAACGCGTTTATCTACATCGTCGAAGGAGAGGGGGTGTTTGGCGTCCCGAATTCACAGC
rJMSF009F08+ GGAACGCGTTTATCTACATCGTCGAAGGAGAGGGGGTGTTTGGCGTCCCGAATTCACAGC
rJMFF008E15+ GGAACGCGTTTATCTACATCGTCGAAGGAGAGGGGGTGTTTGGCGTCCCGAATTCACAGC
                      ____________________________________________________________
consensus GGAACGCGTTTATCTACATCGTCGAAGGAGAGGGGGTGTTTGGCGTCCCGAATTCACAGC
 
. : . : . : . : . : . :
JMFF008E15- CTGCATCAGCTCACCACTGCTTGGTTTTGGGTCCGGGAGAGGGCCTGAGCGTATGGAACA
rJMSF009F08+ CTGCATCAGCTCACCACTGCTTGGTTTTGGGTCCGGGAGAGGGCCTGAGCGTATGGAACA
rJMFF008E15+ CTGCATCAGCTCACCACTGCTTGGTTTTGGGTCCGGGAGAGGGCCTGAGCGTATGGAACA
                      ____________________________________________________________
consensus CTGCATCAGCTCACCACTGCTTGGTTTTGGGTCCGGGAGAGGGCCTGAGCGTATGGAACA
 
. : . : . : . : . : . :
JMFF008E15- AGGGGTCCACACCCCTGAGATTCGTTTTGTTGGGTGGACAGCCACTCAACGAGCCGGTTG
rJMSF009F08+ AGGGGTCCACACCCCTGAGATTCGTTTTGTTGGGTGGACAGCCACTCAACGAGCCGGTTG
rJMFF008E15+ AGGGGTCCACACCCCTGAGATTCGTTTTGTTGGGTGGACAGCCACTCAACGAGCCGGTTG
                      ____________________________________________________________
consensus AGGGGTCCACACCCCTGAGATTCGTTTTGTTGGGTGGACAGCCACTCAACGAGCCGGTTG
 
. : . : . : . : . : . :
JMFF008E15- TTCAGTATGGTCCTTTTGTGATGAACACACAAGCTGAAATCGAGCAGACCTTCCAGGACT
rJMSF009F08+ TTCAGTATGGTCCTTTTGTGATGAACACACAAGCTGAAATCGAGCAGACCTTCCAGGACT
rJMFF008E15+ TTCAGTATGGTCCTTTTGTGATGAACACACAAGCTGAAATCGAGCAGACCTTCCAGGACT
                      ____________________________________________________________
consensus TTCAGTATGGTCCTTTTGTGATGAACACACAAGCTGAAATCGAGCAGACCTTCCAGGACT
 
. : . : . : . : . : . :
JMFF008E15- ACCATTACTACAAGAATGGTTTTGAGAAGGCAAGGCACTGGAGATCTCATTCTGGACACT
rJMSF009F08+ ACCATTACTACAAGAATGGTTTTGAGAAGGCAAGGCACTGGAGATCTCATTCTGGACACT
rJMFF008E15+ ACCATTACTACAAGAATGGTTTTGAGAAGGCAAGGCACTGGAGATCTCATTCTGGACACT
                      ____________________________________________________________
consensus ACCATTACTACAAGAATGGTTTTGAGAAGGCAAGGCACTGGAGATCTCATTCTGGACACT
 
. : . : . : . : . : . :
JMFF008E15- AGGAAGGCCCCCATAGCCCATGTAATGATAAGAAAAGCTCCAATAGAATTTCATTTGAGA
rJMSF009F08+ AGGAAGGCCCCCATAGCCCATGTAATGATAAGAAAAGCTCCAATAGAATTTCATTTGAGA
rJMFF008E15+ AGGAAGGCCCCCATAGCCCATGTAATGATAAGAAAAGCTCCAATAGAATTTCATTTGAGA
                      ____________________________________________________________
consensus AGGAAGGCCCCCATAGCCCATGTAATGATAAGAAAAGCTCCAATAGAATTTCATTTGAGA
 
. : . : . : . : . : . :
JMFF008E15- AAAAGAATAAAATACTAGACTGTGGAGGATTAGACTTTGTCTTCCATCATGTCTTAATCT
rJMSF009F08+ AAAAGAATAAAATACTAGACTGTGGAGGATTAGACTTTGTCTTCCATCATGTCTTAATCT
rJMFF008E15+ AAAAGAATAAAATACTAGACTGTGGAGGATTAGACTTTGTCTTCCATCATGTCTTAATCT
                      ____________________________________________________________
consensus AAAAGAATAAAATACTAGACTGTGGAGGATTAGACTTTGTCTTCCATCATGTCTTAATCT
 
. : . : . : . : . : . :
JMFF008E15- TTCTCCAA
rJMSF009F08+ TTCTCCAAACCCACCTAATATGGAAGCTTGGGTAAGATAGGTACTTTAATATATATCAAG
rJMFF008E15+ TTCTCCAAACCCACCTAATATGGAAGCTTGGGTAAGATAGGTACTTTAATATATATCAAG
                      ____________________________________________________________
consensus TTCTCCAAACCCACCTAATATGGAAGCTTGGGTAAGATAGGTACTTTAATATATATCAAG
 
. : . : . : . : . : . :
rJMSF009F08+ AATGCTAAAGCCTCTAGAAGCCTTAGCTAGCTTCATGTATTATATAGTTTGATATACTT
rJMFF008E15+ AATGCTAAAGCCTCTAGAAGCCTTAGCTAGCTTCATGTATTATATAGTTTGATATACTTT
                      ____________________________________________________________
consensus AATGCTAAAGCCTCTAGAAGCCTTAGCTAGCTTCATGTATTATATAGTTTGATATACTTT