Previous Contig 008539:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008E14Sequence639008539 (3)gb:ATRRBP1A_15541205e-28A.thaliana mRNA for AtRanBP1a protein.
JMFN008E22Sequence639008539 (3)gb:ATRRBP1A_15541202e-30A.thaliana mRNA for AtRanBP1a protein.
JMSF044P20Sequence685008539 (3)gb:ATRRBP1A_15541202e-74A.thaliana mRNA for AtRanBP1a protein.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044P20- GATTCAAAAATCGCCCCCGTTATTATATCAACCTCCTCAAAAATC
                      ____________________________________________________________
consensus GATTCAAAAATCGCCCCCGTTATTATATCAACCTCCTCAAAAATC
 
. : . : . : . : . : . :
JMSF044P20- GAACCCTTCACTCTTCACTTACTCCCTCTAGAAACTTCTGCGATTTTTAATCACCATTTC
                      ____________________________________________________________
consensus GAACCCTTCACTCTTCACTTACTCCCTCTAGAAACTTCTGCGATTTTTAATCACCATTTC
 
. : . : . : . : . : . :
JMSF044P20- AGATACGCATCTACTACCAATGGCCAGCACCGAGCCTGAGAACCAGCACAGGGAGGAGGA
                      ____________________________________________________________
consensus AGATACGCATCTACTACCAATGGCCAGCACCGAGCCTGAGAACCAGCACAGGGAGGAGGA
 
. : . : . : . : . : . :
JMSF044P20- AGAAGCCGTCGGAGCGGATGATGAGGACACCGGAGCTCAGGTTGCGCCTATCGTTAAGCT
                      ____________________________________________________________
consensus AGAAGCCGTCGGAGCGGATGATGAGGACACCGGAGCTCAGGTTGCGCCTATCGTTAAGCT
 
. : . : . : . : . : . :
JMSF044P20- TGAAGAGGTTGCAGTTACTACCGGCGAGGAAGATGAAGACGCCATCCTCGACTTAAAGTC
                      ____________________________________________________________
consensus TGAAGAGGTTGCAGTTACTACCGGCGAGGAAGATGAAGACGCCATCCTCGACTTAAAGTC
 
. : . : . : . : . : . :
JMSF044P20- GAAGCTTTATCGGTATGATAAGGATGGGAATCAATGGAAAGAGAGAGGCGCCGGCACAGT
                      ____________________________________________________________
consensus GAAGCTTTATCGGTATGATAAGGATGGGAATCAATGGAAAGAGAGAGGCGCCGGCACAGT
 
. : . : . : . : . : . :
JMSF044P20- CAAGCTCTTGAAGCATAAGGAGACCGGAAAAGTCCGCCTTGTTATGCGCCAGTCGAAGAC
                      ____________________________________________________________
consensus CAAGCTCTTGAAGCATAAGGAGACCGGAAAAGTCCGCCTTGTTATGCGCCAGTCGAAGAC
 
. : . : . : . : . : . :
JMSF044P20- ACTTAAGATTTGCGCTAATCATCTTGTACTACCATCAATGACTGTTCAGGAACATGCTGG
JMFN008E22+ TCATCTCGTGCTACCGTCAATGACAATTCAGGAACATGCTGG
rJMFF008E14+ TCATCTCGTGCTACNGTCAATGACAATTCAGGAACATGCTGG
                      ____________________________________________________________
consensus ACTTAAGATTTGCGCTAATCATCTCGTGCTACCGTCAATGACAATTCAGGAACATGCTGG
 
. : . : . : . : . : . :
JMSF044P20- CAACGACAAGTCTTGTGTGTGGCATGCACCAGATTTTGCAGATGGTGAACTCAAGGATGA
JMFN008E22+ AAACGAAAAGTCTTGCTTGTGGCATGCAGCGGATTTTGCAGATGGTGAACTAAAGGATGA
rJMFF008E14+ AAACGAAAAGTCTTGCTTNTGGCATGCAGCGGATTTTGCAGATGGTGAACTAAAGGATGA
                      ____________________________________________________________
consensus AAACGAAAAGTCTTGCTTGTGGCATGCAGCGGATTTTGCAGATGGTGAACTAAAGGATGA
 
. : . : . : . : . : . :
JMSF044P20- GCTTTTCTGTATCCGATTTTCATCTGTGGAGAATTGCAAGAACTTCATGGAGACATTCCA
JMFN008E22+ GCTTTTCTGCATCCGCTTTTCATCTGTGGAGAATTGCAAGACTTTCATGGAGATGTTTCA
rJMFF008E14+ GCTTTTCTGCATCCGCTTTTCATCTGTGGAGAATTGCAAGACTTTCATGGAGATGTTTCA
                      ____________________________________________________________
consensus GCTTTTCTGCATCCGCTTTTCATCTGTGGAGAATTGCAAGACTTTCATGGAGATGTTTCA
 
. : . : . : . : . : . :
JMSF044P20- AGAGATTGCTGAATCACAGAAGAAGAATGAGGAAAACAAAGACGCTTCTGCTGCTGCTGG
JMFN008E22+ AGAGGTTGCTGAATCCCAG---AAGAAAGAAGAAAACAAAGATGCATCTGATACTGCTGG
rJMFF008E14+ AGAGGTTGNTGAATCACAG---AAGAAAGAAGNAAACAAAGATGCATCTGATACTGCTGG
                      ____________________________________________________________
consensus AGAGGTTGCTGAATCACAG---AAGAAAGAAGAAAACAAAGATGCATCTGATACTGCTGG
 
. : . : . : . : . : . :
JMSF044P20- ACTGCTTGAGAAATTGAGTGTTGAAGA
JMFN008E22+ ACTGCTTGAGAAGTTGAGTGTTGAAGAGAAGAAGGCTGAAGAGAAAACTGAGGAGAAGGT
rJMFF008E14+ ACTGCTTGAGAAGTTGAGTGTTGAAGAGAAGAAGGCTGAAGAGAANACTGAGGAGAAGGT
                      ____________________________________________________________
consensus ACTGCTTGAGAAGTTGAGTGTTGAAGAGAAGAAGGCTGAAGAGAAAACTGAGGAGAAGGT
 
. : . : . : . : . : . :
JMFN008E22+ GGAAGAGAAAAGCGAGAAAGAGACTTCTGTTGAAAGTGAGGGGAAGGCATCAGAAGTTGC
rJMFF008E14+ GGAAGAGAAAAGCGAGAAAGNGACTTCTGTTGAAAGTGAGGGGAAGGCATCAGAAGTTGC
                      ____________________________________________________________
consensus GGAAGAGAAAAGCGAGAAAGAGACTTCTGTTGAAAGTGAGGGGAAGGCATCAGAAGTTGC
 
. : . : . : . : . : . :
JMFN008E22+ AGAGAAGAAGGATGAGTCCTCTTCAACTTAAAGTATGCACATGCAATGTTCGTTGCCCTT
rJMFF008E14+ AGAGAAGAAGGATGAGTCCTCTTCAACTTAAAGTATGCACANGCAATGTTCGNTGCCCTT
                      ____________________________________________________________
consensus AGAGAAGAAGGATGAGTCCTCTTCAACTTAAAGTATGCACATGCAATGTTCGTTGCCCTT
 
. : . : . : . : . : . :
JMFN008E22+ GGTCAAAATATAAGGGATGATGATTTTTTCGCGGGGAGTGTTTGGGTTTCTTGGTCTGTC
rJMFF008E14+ GGTCAAAATATAAGGGATGATGATTTTTTCGCGGGGAGTGTTTGGGTTTCTTGGTCTGTC
                      ____________________________________________________________
consensus GGTCAAAATATAAGGGATGATGATTTTTTCGCGGGGAGTGTTTGGGTTTCTTGGTCTGTC
 
. : . : . : . : . : . :
JMFN008E22+ ATTTTAGTCAGTCTAATGTTCTGGCAAACTCAGGGGAGGGGAAGGGGTTGGGGGATTGGG
rJMFF008E14+ ATTTTAGTCAGTCTAATGTTCTGGCAAACTCAGGGGAGGGGAAGGGGNTGGGGGATTGGG
                      ____________________________________________________________
consensus ATTTTAGTCAGTCTAATGTTCTGGCAAACTCAGGGGAGGGGAAGGGGTTGGGGGATTGGG
 
. : . : . : . : . : . :
JMFN008E22+ TTTGGATTTCTTAATCTGTCGTTTTAGTCTGTGTAATGCTCTGGCATACTTTTGAGTTTA
rJMFF008E14+ TTTGGATTTCTTAATCNGTCGTTTTAGTCTGNNTAATGCTCTGGCATACTATTGAGTTTA
                      ____________________________________________________________
consensus TTTGGATTTCTTAATCTGTCGTTTTAGTCTGTGTAATGCTCTGGCATACTTTTGAGTTTA
 
. : . : . : . : . : . :
JMFN008E22+ AGGTTAAGGTCTCATTCTG
rJMFF008E14+ AGGNTAAGNTCTCATTCTGNTTACAAGGTATTTGCGCCAGGCATAACACAAATTCATGCC
                      ____________________________________________________________
consensus AGGTTAAGGTCTCATTCTGNTTACAAGGTATTTGCGCCAGGCATAACACAAATTCATGCC