Previous Contig 008538:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008E08Sequence541001163 (6)gb:AY084387_15694772e-36Arabidopsis thaliana clone 106539 mRNA, complete sequence.655008538 (3)gb:AF436834_17998862e-40Arabidopsis thaliana AT3g14240/MLN21_2 mRNA, complete cds.
JMFF017E03Sequence508001163 (6)gb:AY084387_15694778e-39Arabidopsis thaliana clone 106539 mRNA, complete sequence.635008538 (3)gb:AF436834_17998861e-49Arabidopsis thaliana AT3g14240/MLN21_2 mRNA, complete cds.
JMFF023P16Sequence490001163 (6)gb:AY084387_15694777e-25Arabidopsis thaliana clone 106539 mRNA, complete sequence.700008538 (3)gb:AF436834_17998862e-51Arabidopsis thaliana AT3g14240/MLN21_2 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023P16+ TACACCACC
                      ____________________________________________________________
consensus TACACCACC
 
. : . : . : . : . : . :
rJMFF017E03+ TCATCACCAGAAAATACGCNGATTGCCGCGGCGCCAAACGCGCCGGC
rJMFF023P16+ AAAAACATCCACGTCATCACCAGAAAATACGCCGATTGCCGCGGCGCCAAACGCGCCGGC
                      ____________________________________________________________
consensus AAAAACATCCACGTCATCACCAGAAAATACGCCGATTGCCGCGGCGCCAAACGCGCCGGC
 
. : . : . : . : . : . :
rJMFF017E03+ CACGTCGGAAACCTCAACTACCCGTCATTCTCCGCCGTTTTCCAACAATACAGCAAGCAC
rJMFF023P16+ CACGTNGGAAACCTCAACTACCCGTCATTCTCCGCCGTTTTCCAACAATACAGCAAGCAC
rJMFF008E08+ GGAAACCTCAACTACCCGTCATTNTCCGCCGTTTTCCAACAATACAGCANGCAC
                      ____________________________________________________________
consensus CACGTCGGAAACCTCAACTACCCGTCATTCTCCGCCGTTTTCCAACAATACAGCAAGCAC
 
. : . : . : . : . : . :
rJMFF017E03+ AAACTCTCCACCCACTTCATAAGAACAGTCACCAACGTCGGCGACCCAGACTCCGTCTAC
rJMFF023P16+ AAACTCTCCACCCACTTCATAAGAACAGTCACCAACGTCGGCGACCCAGACTCCGTCTAC
rJMFF008E08+ AAACTCTCCACCCACTTCATAAGAACAGTCACCAACGTCGGCGACCCAGACTCCGTCTAC
                      ____________________________________________________________
consensus AAACTCTCCACCCACTTCATAAGAACAGTCACCAACGTCGGCGACCCAGACTCCGTCTAC
 
. : . : . : . : . : . :
rJMFF017E03+ ACCGTTTCCATCAACACCCCGCCCGGAACAACGGTGACGGTGGAGCCGGCGCGGCTGCCA
rJMFF023P16+ ACCGTTTCCATCAACACCCCGCCCGGAACAACGGTGACGGTGGAGCCGGCGCGGCTGCCA
rJMFF008E08+ ACCGTTTCCATCAACACCCCGCCCGGAACAACGGTGACGGTGGAGCCGGCGCGGCTGCCA
                      ____________________________________________________________
consensus ACCGTTTCCATCAACACCCCGCCCGGAACAACGGTGACGGTGGAGCCGGCGCGGCTGCCA
 
. : . : . : . : . : . :
rJMFF017E03+ TTCCGACGAGTGGGCCAAAAACTCAACTTTCTCCTCCGGGTACAAACAGAAGAAGTGAAA
rJMFF023P16+ TTCCGACGAGTGGGCCAAAAACTCAACTTTCTCCTCCGGGTACAAACAGAAGAAGTGAAA
rJMFF008E08+ TTCCGACGAGTGGGCCAAAAACTCAACTTTCTCCTCCGGGTACAAACAGAAGAAGTGAAA
                      ____________________________________________________________
consensus TTCCGACGAGTGGGCCAAAAACTCAACTTTCTCCTCCGGGTACAAACAGAAGAAGTGAAA
 
. : . : . : . : . : . :
rJMFF017E03+ CTATCGCCGGGAAATTCCCGCGTCAGCAGTGGATCAATAACTTGGTCCGACGGAAAACAC
rJMFF023P16+ CTATCGCCGGGAAATTCCCGCGTCAGCAGTGGATCAATAACTTGGTCCGACGGAAAACAC
rJMFF008E08+ CTATCGCCGGGAAATTCCCGCGTCAGCAGTGGATCAATAACTTGGTCCGACGGAAAACAC
                      ____________________________________________________________
consensus CTATCGCCGGGAAATTCCCGCGTCAGCAGTGGATCAATAACTTGGTCCGACGGAAAACAC
 
. : . : . : . : . : . :
rJMFF017E03+ CAAGTTACTTCCCCAATAGTTGTCACATTGCAACAGCCACTCTAATCGACATTCCCGGGA
rJMFF023P16+ CAAGTTACTTCCCCAATAGTTGTCACATTGCAACAGCCACTCTAATCGACATTCCCGGGA
rJMFF008E08+ CAAGTTACTTCCCCAATAGTTGTCACATTGCAACAGCCACTCTAATCGACATTCCCGGGA
                      ____________________________________________________________
consensus CAAGTTACTTCCCCAATAGTTGTCACATTGCAACAGCCACTCTAATCGACATTCCCGGGA
 
. : . : . : . : . : . :
rJMFF017E03+ ATAGATCTATTCCATGAAATGGTATTAGTCATCTATTCCACGAACCAAACACGGTTTNAA
rJMFF023P16+ ATAGATCTATTCCATGAAATGGTATTAGTCATCTATTCCACGAACCAAACACGGTTT-AA
rJMFF008E08+ ATAGATCTATTCCATGAAATGGTATTAGTCATCTATTCCACGAACCAAACACGGTTT-AA
                      ____________________________________________________________
consensus ATAGATCTATTCCATGAAATGGTATTAGTCATCTATTCCACGAACCAAACACGGTTT-AA
 
. : . : . : . : . : . :
rJMFF017E03+ GGTTCATATGTGATATATATATATATAATGTAGTATAAGCCCTGTGGACAGATATCAGAC
rJMFF023P16+ GGTTCATATGTGTTATATATATATATAATGTAGTATAAGCCCTGTGGACAGATATCAGAC
rJMFF008E08+ GGTTCATATGTGTTATATATATATATAATGTAGTATAAGCCCTGTGGACAGATATCAGAC
                      ____________________________________________________________
consensus GGTTCATATGTGTTATATATATATATAATGTAGTATAAGCCCTGTGGACAGATATCAGAC
 
. : . : . : . : . : . :
rJMFF017E03+ AGTACACTCTACTATCTGATCTGAGTTAGTAACTTTGTATTGGGTTTTCGTTTTGTAACA
rJMFF023P16+ AGTACACTCTACTATCTGATCTGAGTTAGTAACTTTGTATTGGGTTTTCGTTTTGTAACA
rJMFF008E08+ AGTACACTCTACTATCTGATCTGAGTTAGTAACTTTGTATTGGGTTTTCGTTTTGTAACA
                      ____________________________________________________________
consensus AGTACACTCTACTATCTGATCTGAGTTAGTAACTTTGTATTGGGTTTTCGTTTTGTAACA
 
. : . : . : . : . : . :
rJMFF017E03+ GTTCATAAGCTGAGCTGAGTTTGAGGGATGGATAATCTTTTCTTCTTT
rJMFF023P16+ GTTCATAAGCTGAGCTGAGTTTGAGGGATGGATAATCTTTTCTTCTTTGTTGTAGAATGA
rJMFF008E08+ GTTCATAAGCTGAGCTGAGTTTGAGGGATGGATAATCTTTTCTTCTTTGTTGTAGAATGA
                      ____________________________________________________________
consensus GTTCATAAGCTGAGCTGAGTTTGAGGGATGGATAATCTTTTCTTCTTTGTTGTAGAATGA
 
. : . : . : . : . : . :
rJMFF023P16+ CAATGGATCTTTCAAGTATCT
rJMFF008E08+ CAATGGATCTTTCAAGTATCTTGTGTAAAAAAAAATGTTGTTTTATGCTGAGACAAAGAT
                      ____________________________________________________________
consensus CAATGGATCTTTCAAGTATCTTGTGTAAAAAAAAATGTTGTTTTATGCTGAGACAAAGAT