Previous Contig 008536:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008D19Sequence397006660 (5)gb:AF280812_17828977e-21Glycine max putative Hs1pro-1-like receptor mRNA, complete cds.642008536 (4)pir|T50833|T508337e-50nematode resistance protein Hs1pro-1 [imported] - Beta procumbens>gb:BPU79733_16
JMFF021K09Sequence427006660 (5)gb:AF280812_17828972e-26Glycine max putative Hs1pro-1-like receptor mRNA, complete cds.661008536 (4)pir|T50833|T508336e-64nematode resistance protein Hs1pro-1 [imported] - Beta procumbens>gb:BPU79733_16
JMFF024B22Sequence490006660 (5)gb:AY835406_16303441e-47Hordeum vulgare Hs1 (Hs1) gene, complete cds.>gb:AF307333_1784660 Hordeum vulgar797008536 (4)pir|T50833|T508336e-67nematode resistance protein Hs1pro-1 [imported] - Beta procumbens>gb:BPU79733_16
JMFF027F18Sequence493006660 (5)gb:AF280812_17828971e-34Glycine max putative Hs1pro-1-like receptor mRNA, complete cds.734008536 (4)pir|T50833|T508337e-75nematode resistance protein Hs1pro-1 [imported] - Beta procumbens>gb:BPU79733_16

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027F18+ GGATCTACGCATCAAAGTCGCTTCTAAAT
rJMFF024B22+ CCACGCTGCAGGTACTGGAAACGTGGATCTACGCATCAAAGTCGCTTCTAAAT
                      ____________________________________________________________
consensus CCACGCTGCAGGTACTGGAAACGTGGATCTACGCATCAAAGTCGCTTCTAAAT
 
. : . : . : . : . : . :
rJMFF021K09+ GCCGNAAGCGATNGTTGGATT
rJMFF027F18+ CGGATCTCAGAGAGGATTGATCGAAAGGAATTCGAAAAAGCCGGAAGCGATTGTTGGATT
rJMFF024B22+ CGGATCTCAGAGAGGATTGATCGAAAGGAATTCGAAAAAGCCGGAAGCGATTGTTGGATT
                      ____________________________________________________________
consensus CGGATCTCAGAGAGGATTGATCGAAAGGAATTCGAAAAAGCCGGAAGCGATTGTTGGATT
 
. : . : . : . : . : . :
rJMFF021K09+ CTAGAGAAGACGTGGAAACTCTTAACCGAAATACAAGACCTCCACNTG-CTAATGGATCC
rJMFF027F18+ CTAGAGAAGACGTGGAAACTCTTAACCGAAATACAAGACCTCCACCTG-CTAATGGATCC
rJMFF024B22+ CTAGAGAAGACGTGGAAACTCTTAACCGAAATACAAGACCTCCACCTGNCTAATGGATCC
                      ____________________________________________________________
consensus CTAGAGAAGACGTGGAAACTCTTAACCGAAATACAAGACCTCCACCTG-CTAATGGATCC
 
. : . : . : . : . : . :
rJMFF021K09+ CGACGATTTCCTCCGTCT-AAAAAATCAGTTATCCGTGAAAGCCGTCGCCGAATCGGAGC
rJMFF027F18+ CGACGATTTCCTCCGTCT-AAAAAATCAGTTATCCGTGAAAGCCGTCGCCGAATCGGAGC
rJMFF024B22+ CGACGATTTCCTCCGTCTAAAAAAATCAGTTATCCGTGAAAGCCGTCGCCGAATCGGAGC
rJMFF008D19+ AAAAAATCAGTTATCCGTGAAAGCCGTCGCCGAATCGGAGC
                      ____________________________________________________________
consensus CGACGATTTCCTCCGTCT-AAAAAATCAGTTATCCGTGAAAGCCGTCGCCGAATCGGAGC
 
. : . : . : . : . : . :
rJMFF021K09+ TCTTCTGCTTCCGATCCAGAGAACTGGNGGAGATCACGAAGCTCTCGAAGAGCCTGCGGC
rJMFF027F18+ TCTTCTGCTTCCGATCCAGAGAACTGGTGGAGATCACGAAGCTCTCGAAGAGCCTGCGGC
rJMFF024B22+ TCTTCTGCTTCCGATCCAGAGAACTGGTGGAGATCACGAAGCTCTCGAAGAGCCTGCGGC
rJMFF008D19+ TCTTCTGCTTCCGATCCAGAGAACTGGTGGAGATCACGAAGCTCTCGAAGAGCCTGCGGC
                      ____________________________________________________________
consensus TCTTCTGCTTCCGATCCAGAGAACTGGTGGAGATCACGAAGCTCTCGAAGAGCCTGCGGC
 
. : . : . : . : . : . :
rJMFF021K09+ ACAAAGTCCCCTGTATTCTCGACGTAGAAGTCGATCCTCACGGCGGACCGAGGATCCAGG
rJMFF027F18+ ACAAAGTCCCCTGTATTCTCGACGTAGAAGTCGATCCTCACGGCGGACCGAGGATCCAGG
rJMFF024B22+ ACAAAGTCCCCTGTATTCTCGACGTAGAAGTCGATCCTCACGGCGGACCGAGGATCCAGG
rJMFF008D19+ ACAAAGTCCCCTGTATTCTCGACGTAGAAGTCGATCCTCACGGCGGACCGAGGATCCAGG
                      ____________________________________________________________
consensus ACAAAGTCCCCTGTATTCTCGACGTAGAAGTCGATCCTCACGGCGGACCGAGGATCCAGG
 
. : . : . : . : . : . :
rJMFF021K09+ AGGCGGCGATGGAGCTATACCGGAGGAAAGAAGACTCGGAGAAGATTCATCTGCTTCAAG
rJMFF027F18+ AGGCGGCGATGGAGCTATACCGGAGGAAAGAAGACTCGGAGAAGATTCATCTGCTTCAAG
rJMFF024B22+ AGGCGGCGATGGAGCTATACCGGAGGAAAGAAGACTCGGAGAAGATTCATCTGCTTCAAG
rJMFF008D19+ AGGCGGCGATGGAGCTATACCGGAGGAAAGAAGACTCGGAGAAGATTCATCTGCTTCAAG
                      ____________________________________________________________
consensus AGGCGGCGATGGAGCTATACCGGAGGAAAGAAGACTCGGAGAAGATTCATCTGCTTCAAG
 
. : . : . : . : . : . :
rJMFF021K09+ CTCTTCAAGCCATCGAAATGGCGGTGAAACGGTTTTACTACTCTTACAGGCAGCTTTTGG
rJMFF027F18+ CTCTTCAAGCCATCGAAATGGCGGTGAAACGGTTTTACTACTCTTACAGGCAGCTTTTGG
rJMFF024B22+ CTCTTCAAGCCATCGAAATGGCGGTGAAACGGTTTTACTACTCTTACAGGCAGCTTTTGG
rJMFF008D19+ CTCTTCAAGCCATCGAAATGGCGGTGAAACGGTTTTACTACTCTTACAGGCAGCTTTTGG
                      ____________________________________________________________
consensus CTCTTCAAGCCATCGAAATGGCGGTGAAACGGTTTTACTACTCTTACAGGCAGCTTTTGG
 
. : . : . : . : . : . :
rJMFF021K09+ TGATCGTTATGGGGAGCTTAGAAGCTAAGGCGAATCCGGCGTTGGTGAACGCCGATTCCG
rJMFF027F18+ TGATCGTTATGGGGAGCTTAGAAGCTAAGGCGAATCCGGCGTTGGTGAACGCCGATTCCG
rJMFF024B22+ TGATCGTTATGGGGAGCTTAGAAGCTAAGGCGAATCCGGCGTTGGTGAACGCCGATTCCG
rJMFF008D19+ TGATCGTTATGGGGAGCTTAGAAGCTAAGGCGAATCCGGCGTTGGTGAACGCCGATTCCG
                      ____________________________________________________________
consensus TGATCGTTATGGGGAGCTTAGAAGCTAAGGCGAATCCGGCGTTGGTGAACGCCGATTCCG
 
. : . : . : . : . : . :
rJMFF021K09+ GCGACTTGCTAGCTCAAATATTTCTGGAGCCGACTTATTTTCCGAGCTTGGATGCAGNGA
rJMFF027F18+ GCGACTTGCTAGCTCAAATATTTCTGGAGCCGACTTATTTTCCGAGCTTGGATGCAGCGA
rJMFF024B22+ GCGACTTGCTAGCTCAAATATTTCTGGAGCCGACTTATTTTCCGAGCTTGGATGCAGCGA
rJMFF008D19+ GCGACTTGCTAGCTCAAATATTTCTGGAGCCGACTTATTTTCCGAGCTTGGATGCAGCGA
                      ____________________________________________________________
consensus GCGACTTGCTAGCTCAAATATTTCTGGAGCCGACTTATTTTCCGAGCTTGGATGCAGCGA
 
. : . : . : . : . : . :
rJMFF021K09+ AGACGTTTCTGGGGGAGCAGTGGAGTCGCGATCATGGCAGGTCTAGTCCGGAAAGAAGAG
rJMFF027F18+ AGACGTTTCTGGGGGAGCAGTGGAGTCGCGATCATGGCAGGTCTAGTCCGGAAAGAAGAG
rJMFF024B22+ AGACGTTTCTGGGGGAGCAGTGGAGTCGCGATCATGGCAGGTCTAGTCCGGAAAGAAGAG
rJMFF008D19+ AGACGTTTCTGGGGGAGCAGTGGAGTCGCGATCATGGCAGGTCTAGTCCGGAAAGAAGAG
                      ____________________________________________________________
consensus AGACGTTTCTGGGGGAGCAGTGGAGTCGCGATCATGGCAGGTCTAGTCCGGAAAGAAGAG
 
. : . : . : . : . : . :
rJMFF021K09+ GCAAAAATGAGAAATGAGTTGACTCGATTGGCATTCAACTCAGTGACGTNGTAGTCATTT
rJMFF027F18+ GCAAAAATGAGAAATGAGTTGACTCGATTGGCATTCAACTCAGTGACGTTGTAGTCATTT
rJMFF024B22+ GCAAAAATGAGAAATGAGTTGACTCGATTGGCATTCAACTCAGTGACGTTGTAGTCATTT
rJMFF008D19+ GCAAAAATGAGAAATGAGTTGACTCGATTGGCATTCAACTCAGTGACGTTGTAGTCATTT
                      ____________________________________________________________
consensus GCAAAAATGAGAAATGAGTTGACTCGATTGGCATTCAACTCAGTGACGTTGTAGTCATTT
 
. : . : . : . : . : . :
rJMFF021K09+ GACAGCGAAGCATTATCCAAGTTTTTGCCTAAAATATATTTC
rJMFF027F18+ GACAGCGAAGCATTATCCAAGTTTTTGCCTAAAATATATTTC
rJMFF024B22+ GACAGCGAAGCATTATCCAAGTTTTTGCCTAAAATATATTTCATTATTATTATTTTTGGT
rJMFF008D19+ GACAGCGAAGCATTATCCAAGTTTTTGCCTAAAATATATTTCATTATTATTATTTTTGGT
                      ____________________________________________________________
consensus GACAGCGAAGCATTATCCAAGTTTTTGCCTAAAATATATTTCATTATTATTATTTTTGGT
 
. : . : . : . : . : . :
rJMFF024B22+ ATATATATCTGTAGCATACATGAT
rJMFF008D19+ ATATATATCTGTAGCATACATGATGTTGTATAATACCACTTTTCAAAATTTTGCTGTGCT
                      ____________________________________________________________
consensus ATATATATCTGTAGCATACATGATGTTGTATAATACCACTTTTCAAAATTTTGCTGTGCT