Previous Contig 008509:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007L06Sequence614005381 (5)gb:AP005536_18537032e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN637008509 (6)gb:AP005536_18537032e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMFF027I14Sequence613005381 (5)gb:AP005536_18537031e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN705008509 (6)gb:AP005536_18537039e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMSF006B04Sequence348008509 (6)gb:AP005536_18537031e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMSF007B02Sequence828008509 (6)gb:AB075740_15233385e-34Arabidopsis thaliana mRNA for MFDR, complete cds.>gb:AY074927_1567729 Arabidopsi
JMSF013C23Sequence225005381 (5)gb:AB075740_15233387e-21Arabidopsis thaliana mRNA for MFDR, complete cds.>gb:AY074927_1567729 Arabidopsi763008509 (6)gb:AP005536_18537033e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN
JMSF034A10Sequence668005381 (5)gb:AP005536_18537031e-69Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN763008509 (6)gb:AP005536_18537033e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007B02+ GT
                      ____________________________________________________________
consensus GT
 
. : . : . : . : . : . :
rJMSF034A10+ GAAT
rJMSF013C23+ GAAT
rJMSF007B02+ TTTGNAGAGTNTCGGTTATAAATCAGTATGTGTTGAGGGCTACCTTTTGATCCCCGGAAT
                      ____________________________________________________________
consensus TTTGNAGAGTNTCGGTTATAAATCAGTATGTGTTGAGGGCTACCTTTTGATCCCCGGAAT
 
. : . : . : . : . : . :
rJMSF034A10+ GGTATGCGAAAGAAATGCAGCTCTGCAGAAAATTTATTCTACCATATGTATTTTCCTAAT
rJMSF013C23+ GGTATGCGAAAGAAATGCAGCTCTGCAGAAAATTTATTCTACCATATGTATTTTCCTAAT
rJMSF007B02+ GGTATGCGAAAGAAATGCAGCTNTGCAGAAAANTTATTCTACCATATGTATTTTCCTAAT
                      ____________________________________________________________
consensus GGTATGCGAAAGAAATGCAGCTCTGCAGAAAATTTATTCTACCATATGTATTTTCCTAAT
 
. : . : . : . : . : . :
rJMSF034A10+ TG-TTTTCAAAATTCTGGGCGAATACTATGGTTTCTATGCTTATGAAAATTTAATATACT
rJMSF013C23+ TG-TTTTCAAAATTCTGGGCGAATACTATGGTTTCTATGCTTATGAAAATTTAATATACT
rJMSF007B02+ NGTTTTTCAAANTTCTGGGCGAATANTATGGTTTCTATGCTTATGAAAATTTAATATACT
rJMFF027I14+ TTCAAAATTCTGGGCGAATACTATGGTTTCTATGCTTATGAAAATTTAATATACT
                      ____________________________________________________________
consensus TG-TTTTCAAAATTCTGGGCGAATACTATGGTTTCTATGCTTATGAAAATTTAATATACT
 
. : . : . : . : . : . :
rJMSF034A10+ CATATGATTCTTAGTCTTGGTTTCCTTCCGGCTTCCCCAGGCATAGTTCCAAACATTAGA
rJMSF013C23+ CATATGATTCTTAGTCTTGGTTTCCTTCCGGCTTCCCCAGGCATAGTTCCAAACATTAGA
rJMSF007B02+ CATATGATTCTTAGTCTTGGTTTCCTTCCGGCTTCCCCAGGCATAGTTCCAAACATTAGA
rJMFF027I14+ CATATGATTCTTAGTCTTGGTTTCCTTCCGGCTTCCCCAGGCATAGTTCCAAACATTAGA
rJMFF007L06+ CCTTCCGGCTTCCCCAGGCATAGTTCCAAACATTAGA
                      ____________________________________________________________
consensus CATATGATTCTTAGTCTTGGTTTCCTTCCGGCTTCCCCAGGCATAGTTCCAAACATTAGA
 
. : . : . : . : . : . :
rJMSF034A10+ GGTCGTGTCCTAAGTGATTCTACAGGAGACCTCACAGAGGTCGAGAAGGGTTTATACGTA
rJMSF013C23+ GGTCGTGTCCTAAGTGATTCTACAGGAGACCTCACAGAGGTCGAGAAGGGTTTATACGTA
rJMSF007B02+ GGTCGTGTCNTAAGTGATTCTACAGGAGACCTCACAGAGGTCGAGAAGGGTTTATACGTA
rJMFF027I14+ GGTCGTGTCNTAAGTGATTCTACAGGAGACCTCACAGAGGTCGAGAAGGGTTTATACGTA
rJMFF007L06+ GGTCGTGTCCTAAGTGATTCTACAGGAGACCTCACAGAGGTCGAGAAGGGTTTATACGTA
                      ____________________________________________________________
consensus GGTCGTGTCCTAAGTGATTCTACAGGAGACCTCACAGAGGTCGAGAAGGGTTTATACGTA
 
. : . : . : . : . : . :
rJMSF034A10+ TGTGGTTGGTTGAAAAGAGGACCAACTGGAATCATCGCTACCAATCTTTACTGTGCTGAA
rJMSF013C23+ TGTGGTTGGTTGAAAAGAGGACCAACTGGAATCATCGCTACCAATCTTTACTGTGCTGAA
rJMSF007B02+ TGTGGTTGGTTGAAAGGAGGACCAACTGGAATCATCGCTACCAATCTTTNCTGTGCTGAA
rJMFF027I14+ TGTGGTTGGTTGAAAAGAGGACCAACTGGAATCATCGCTACCAATCTTTACTGTGCTGAA
rJMFF007L06+ TGTGGTTGGTTGAAAAGAGGACCAACTGGAATCATCGCTACCAATCTTTACTGTGCTGAA
                      ____________________________________________________________
consensus TGTGGTTGGTTGAAAAGAGGACCAACTGGAATCATCGCTACCAATCTTTACTGTGCTGAA
 
. : . : . : . : . : . :
rJMSF034A10+ GAAACTGTTGCCAGCATTTCTGAAGATATCAAGAAAGGAATTCTACCATCCACATCTGAC
rJMSF013C23+ GAAACTGTTGCCAGCATTTCTGAAGATATCAAGAAAGGAATTCTACCATCCACATCTGAC
rJMSF007B02+ GAAACTGTTGCCAGCATTTCTGAAGATATCAAGAAAGGAATTCTACCATCCNCATCTGNC
rJMFF027I14+ GAAACTGTTGCCAGCATTTCTGAAGATATCAAGAAAGGAATTCTACCATCCACATCTGAC
rJMFF007L06+ GAAACTGTTGCCAGCATTTCTGAAGATATCAAGAAAGGAATTCTACCATCCACATCTGAC
                      ____________________________________________________________
consensus GAAACTGTTGCCAGCATTTCTGAAGATATCAAGAAAGGAATTCTACCATCCACATCTGAC
 
. : . : . : . : . : . :
rJMSF034A10+ CCATCAAAGCCGGGGAGGGAGGGCCTCCTTCAACTACTGGACAGTAAGAACTCCACAGTC
rJMSF013C23+ CCATCAAAGCCGGGGAGGGAGGGCCTCCTTCAACTACTGGACAGTAAGAACTCCACAGTC
rJMSF007B02+ CCATCAAAGCCGGGGAGGGAGGGCCTCCTTCAACTACTGGACAGTAAGAACTCCACAGTC
rJMFF027I14+ CCATCAAAGCCGGGGAGGGAGGGCCTCCTTCAACTACTGGACAGTAAGAACTCCACAGTC
rJMSF006B04+ TCCACAGTC
rJMFF007L06+ CCATCAAAGCCGGGGAGGGAGGGCCTCCTTCAACTACTGGACAGTAAGAACTCCACAGTC
                      ____________________________________________________________
consensus CCATCAAAGCCGGGGAGGGAGGGCCTCCTTCAACTACTGGACAGTAAGAACTCCACAGTC
 
. : . : . : . : . : . :
rJMSF034A10+ ATCCCATTCGAGGGCTGGCAGAAGATCGATGCTGAAGAGAAAAGGCGAGGGTGTTTGAAA
rJMSF013C23+ ATCCCATTCGAGGGCTGGCAGAAGATCGATGCTGAAGAGAAAAGGCGAGGGTGTTTGAAA
rJMSF007B02+ ATNCCATTCGAGGGNTGGCAGAAGATCGANGCTGAAGAGAAAAGGCGAGGGTGTTTGAAA
rJMFF027I14+ ATCCCATTCGAGGGCTGGCAGAAGATCGATGCTGAAGAGAAAAGGCGAGGGTGTTTGAAA
rJMSF006B04+ ATCCCATTCGAGGGCTGGCAGAAGATCGATGCTGAAGAGAAAAGGCGAGGGTGTTTGAAA
rJMFF007L06+ ATCCCATTCGAGGGCTGGCAGAAGATCGATGCTGAAGAGAAAAGGCGAGGGTGTTTGAAA
                      ____________________________________________________________
consensus ATCCCATTCGAGGGCTGGCAGAAGATCGATGCTGAAGAGAAAAGGCGAGGGTGTTTGAAA
 
. : . : . : . : . : . :
rJMSF034A10+ AACAAACCCAGAGAAAAACTCACCAGTTGGCAGGAACTACTTGAAGTTGCCAGGAAATGA
rJMSF013C23+ AACAAACCCAGAGAAAAACTCACCAGTTGGCAGGAACTACTTGAAGTTGCCAGGAAATGA
rJMSF007B02+ ANCAAACCCAGAGAAAAACTCACCAGTTGGCAGGANCTACTTGAAGTTGCCAGGAAATGN
rJMFF027I14+ AACAAACCCAGAGAAAAACTCACCAGTTGGCAGGAACTACTTGAAGTTGCCAGGAAATGA
rJMSF006B04+ AACAAACCCAGAGAAAAACTCACCAGTTGGCAGGAACTACTTGAAGTTGCCAGGAAATGA
rJMFF007L06+ AACAAACCCAGAGAAAAACTCACCAGTTGGCAGGAACTACTTGAAGTTGCCAGGAAATGA
                      ____________________________________________________________
consensus AACAAACCCAGAGAAAAACTCACCAGTTGGCAGGAACTACTTGAAGTTGCCAGGAAATGA
 
. : . : . : . : . : . :
rJMSF034A10+ GGATTCTCACAAATCAGAACATAATTCGGTTTTGACAGCAATGCCCCCCGCCCGATTCAA
rJMSF013C23+ GGATTCTCACAAATCAGAACATAATTCGGTTTTGACAGCAATGCCCCCCGCCCGATTCAA
rJMSF007B02+ GGATTCTCACAAATCAGAACATAATTCGGTTTTGACAGCAATGCCCCCCGCCCGATTCAA
rJMFF027I14+ GGATTCTCACAAATCAGAACATAATTCGGTTTTGACAGCAATGCCCCCCGCCCGATTCAA
rJMSF006B04+ GGATTCTCACAAATCAGAACATAATTCGGTTTTGACAGCAATNCCCCCCGCCCGATTCAA
rJMFF007L06+ GGATTCTCACAAATCAGAACATAATTCGGTTTTGACAGCAATGCCCCCCGCCCGATTCAA
                      ____________________________________________________________
consensus GGATTCTCACAAATCAGAACATAATTCGGTTTTGACAGCAATGCCCCCCGCCCGATTCAA
 
. : . : . : . : . : . :
rJMSF034A10+ TCCTTTTCTGATTACGAATGACATTTCACTTCTGGGTTAGTATACATGACTTGAGCTGTA
rJMSF013C23+ TCCTTTTCTGATTACGAATGACATTTCACTTCTGGGTTAGTATACATGACTTGAGCTGTA
rJMSF007B02+ TCCTTTTCTGATTACGAATGACATTTCACNTCTGGGTTAGTATACATGACNTGAGCNGTA
rJMFF027I14+ TCCTTTTCTGATTACGAATGACATTTCACTTCTGGGTTAGTATACATGACTTGAGCTGTA
rJMSF006B04+ TCCTTTTCTGATTACGAATGACATTTCACTTCTGGGTTAGTATACATGACTTGAGCTGTA
rJMFF007L06+ TCCTTTTCTGATTACGAATGACATTTCACTTCTGGGTTAGTATACATGACTTGAGCTGTA
                      ____________________________________________________________
consensus TCCTTTTCTGATTACGAATGACATTTCACTTCTGGGTTAGTATACATGACTTGAGCTGTA
 
. : . : . : . : . : . :
rJMSF034A10+ TTGCATTCTTGGAGTTTATACATTAGGCTAGAAATAATTATTTCTTGAATAATTGAAGCT
rJMSF013C23+ TTGCATTCTTGGAGTTTATACATTAGGCTAGAAATAATTATTTCTTGAATAATTGAAGCT
rJMSF007B02+ TNGCATTCTTGGAGTTTATACATTAGGCTAGAAATAATTATTTCTTGAATAATTGAAGCT
rJMFF027I14+ TTGCATTCTTGGAGTTTATACATTAGGCTAGAAATAATTATTTCTTGAATAATTGAAGCT
rJMSF006B04+ TTGCATTCTTGGAGTNTATACATTAGGCTAGAAATAATTATTTCTTGAATAATTGAAGCT
rJMFF007L06+ TTGCATTCTTGGAGTTTATACATTAGGCTAGAAATAATTATTTCTTGAATAATTGAAGCT
                      ____________________________________________________________
consensus TTGCATTCTTGGAGTTTATACATTAGGCTAGAAATAATTATTTCTTGAATAATTGAAGCT
 
. : . : . : . : . : . :
rJMSF034A10+ CTTGTATGGTGCTAATGTTGTTATAGTCCCAGATGCTCT
rJMSF013C23+ CTTGTATGGTGCTAATGTTGTTATAGTCCCAGATGCTCT
rJMSF007B02+ CTNGTATGGTGCTAATGTTGTTATAGTCCCAGATGCTCT
rJMFF027I14+ CTTGTATGGTGCTAATGTTGTTATAGTCCCAGATGCTCT
rJMSF006B04+ CTTGTANGGTGCTAATGTTGTTATAGTCCCAGA
rJMFF007L06+ CTTGTATGGTGCTAATGTTGTTATAGTCCCAGATGCTCTTGAGAAACAAAATTCTTCTTA
                      ____________________________________________________________
consensus CTTGTATGGTGCTAATGTTGTTATAGTCCCAGATGCTCTTGAGAAACAAAATTCTTCTTA