Previous Contig 008508:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007K24Sequence557006645 (5)gb:AY059897_15647415e-38Arabidopsis thaliana receptor protein kinase-like protein (At5g67200; K21H1.16) 628008508 (5)gb:AY059897_15647416e-43Arabidopsis thaliana receptor protein kinase-like protein (At5g67200; K21H1.16)
JMFF030I03Sequence351006645 (5)gb:AY059897_15647413e-19Arabidopsis thaliana receptor protein kinase-like protein (At5g67200; K21H1.16) 674008508 (5)gb:AB008267_15104276e-67Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMG4.
JMFS020E11Sequence605008508 (5)gb:AY059897_15647411e-45Arabidopsis thaliana receptor protein kinase-like protein (At5g67200; K21H1.16)
JMSF030C02Sequence672006645 (5)pir|T45569|T455692e-19receptor protein kinase-like protein - Arabidopsis thaliana>gb:ATF11C1_1548241 A636008508 (5)gb:AB008267_15104272e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMG4.
JMSF052G17Sequence681006645 (5)gb:AY059897_15647412e-56Arabidopsis thaliana receptor protein kinase-like protein (At5g67200; K21H1.16) 910008508 (5)gb:AB008267_1510427e-109Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MMG4.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052G17+ AGGTGTATACTTTGGAG
                      ____________________________________________________________
consensus AGGTGTATACTTTGGAG
 
. : . : . : . : . : . :
rJMSF052G17+ CAGCTGATGAAAGCCTCGGCGGAGCTTCTGGGGCGGGGAACGCTGGGCACCACCTACAAG
                      ____________________________________________________________
consensus CAGCTGATGAAAGCCTCGGCGGAGCTTCTGGGGCGGGGAACGCTGGGCACCACCTACAAG
 
. : . : . : . : . : . :
rJMSF052G17+ GCGGTGCTCGACAACCGTTTGATTGTTTGCGTGAAAAGATTAGACTCTGGGAAAATGGCG
                      ____________________________________________________________
consensus GCGGTGCTCGACAACCGTTTGATTGTTTGCGTGAAAAGATTAGACTCTGGGAAAATGGCG
 
. : . : . : . : . : . :
rJMSF052G17+ GGTAGCAGTAAGGATGAGTTTGAACGGCACATGGAATCAGTGGGCGGATTGCGCCACCCA
                      ____________________________________________________________
consensus GGTAGCAGTAAGGATGAGTTTGAACGGCACATGGAATCAGTGGGCGGATTGCGCCACCCA
 
. : . : . : . : . : . :
rJMSF052G17+ AATTTGGTTCCTCTCAGAGCTTATTTCCAGGCCAAGGAAGAACGCCTTCTGGTCTATGAT
rJMFF030I03+ CTATGAT
                      ____________________________________________________________
consensus AATTTGGTTCCTCTCAGAGCTTATTTCCAGGCCAAGGAAGAACGCCTTCTGGTCTATGAT
 
. : . : . : . : . : . :
rJMSF052G17+ TACCAGCCCAATGGCAGTCTCTTCTCCCTTATCCATGGTTCTAAGTCCTCAAGAGCAAAG
rJMSF030C02+ TTATCCATGGTTCTAAGTCCTCAAGAGCAAAG
rJMFF030I03+ TACCAGCCCAATGGCAGTCTCTTCTCCCTTATCCATGGTTCTAAGTCCTCAAGAGCAAAG
                      ____________________________________________________________
consensus TACCAGCCCAATGGCAGTCTCTTCTCCCTTATCCATGGTTCTAAGTCCTCAAGAGCAAAG
 
. : . : . : . : . : . :
rJMSF052G17+ CCACTTCACTGGACTTCGTGCTTGAAAATAGCAGAGGATGTAGCTCAAGGCCTCTCGTAT
rJMSF030C02+ CCACTTCACTGGACTTCGTGCTTGAAAATAGCAGAGGATGTAGCTCAAGGCCTCTCGTAT
rJMFF030I03+ CCACTTCACTGGACTTCGTGCTTGAAAATAGCAGAGGATGTAGCTCAAGGCCTCTCGTAT
                      ____________________________________________________________
consensus CCACTTCACTGGACTTCGTGCTTGAAAATAGCAGAGGATGTAGCTCAAGGCCTCTCGTAT
 
. : . : . : . : . : . :
rJMSF052G17+ ATCCACCAAGCATGGAGGCTGGTTCACGGCAACCTCAAGTCCTCTAATGTCCTCCTGGGA
rJMSF030C02+ ATCCACCAAGCATGGAGGCTGGTTCACGGCAACCTCAAGTCCTCTAATGTCCTCCTGGGA
rJMFF030I03+ ATCCACCAAGCATGGAGGCTGGTTCACGGCAACCTCAAGTCCTCTAATGTCCTCCTGGGA
JMFS020E11+ CAAGCATGNAGGCTGGTTCACGGCAACCTCAAGTCCTCTAATGTCCTCCTGGGA
rJMFF007K24+ CCTCAAGTCCTCTAATGTCCTCCTGGGA
                      ____________________________________________________________
consensus ATCCACCAAGCATGGAGGCTGGTTCACGGCAACCTCAAGTCCTCTAATGTCCTCCTGGGA
 
. : . : . : . : . : . :
rJMSF052G17+ TCCGATTTCGAGGCCTGCATTTCTGATTACTGCCTCTCGGTCTTAGCCAACCCCTTCTCA
rJMSF030C02+ TCCGATTTCGAGGCCTGCATTTCTGATTACTGCCTCTCGGTCTTAGCCAACCCCTTCTCA
rJMFF030I03+ TCCGATTTCGAGGCCTGCATTTCTGATTACTGCCTCTCGGTCTTAGCCAACCCCTTCTCA
JMFS020E11+ TCCGATTTCGAGGCCTGCATTTCTGATTACTGCCTCTCGGTCTTAGCCAACCCCTTCTCA
rJMFF007K24+ TCCGATTTCGAGGCCTGCATTTCTGATTACTGCCTCTCGGTCTTAGCCAACCCCTTTTCA
                      ____________________________________________________________
consensus TCCGATTTCGAGGCCTGCATTTCTGATTACTGCCTCTCGGTCTTAGCCAACCCCTTCTCA
 
. : . : . : . : . : . :
rJMSF052G17+ GATGACGACCCTGATTGT---GCCTACAAGGCACCCGAGGTTCGAAAACTAAACCCGCAC
rJMSF030C02+ GATGACGACCCTGATTGTGCAGCCTACAAGGCACCCGAGGTTCGAAAACTAAACCCGCAC
rJMFF030I03+ GATGACGACCCTGATTGTGCAGCCTACAAGGCACCCGAGGTTCGAAAACTAAACCCGCAC
JMFS020E11+ GATGACGACCCTGATTGTGCAGCCTACAAGGCACCCGAGGTTCGAAAACTAAACCCGCAC
rJMFF007K24+ GATGACGACCCTGATTGTGCAGCCTACAAGGCACCCGAGGTTCGAAAACTAAACCCGCAC
                      ____________________________________________________________
consensus GATGACGACCCTGATTGTGCAGCCTACAAGGCACCCGAGGTTCGAAAACTAAACCCGCAC
 
. : . : . : . : . : . :
rJMSF052G17+ CATCAAGCAACTTCCAAGTCTGATGTTTACTCCTATGGAGTTCTTGTACTGGAACTGCTT
rJMSF030C02+ CATCAAGCAACTTCCAAGTCTGATGTTTACTCCTATGGAGTTCTTGTACTGGAACTGCTT
rJMFF030I03+ CATCAAGCAACTTCCAAGTCTGATGTTTACTCCTATGGAGTTCTTGTACTGGAACTGCTT
JMFS020E11+ CATCAAGCAACTTCCAAGTCTGATGTTTACTCCTATGGAGTTCTTGTACTGGAACTGCTT
rJMFF007K24+ CATCAAGCAACTTCCAAGTCTGATGTTTACTCCTATGGAGTTCTTGTACTGGAACTGCTT
                      ____________________________________________________________
consensus CATCAAGCAACTTCCAAGTCTGATGTTTACTCCTATGGAGTTCTTGTACTGGAACTGCTT
 
. : . : . : . : . : . :
rJMSF052G17+ ACTGGGAAGCATCCCTCAGAACACCCAGTTCTAATGCCGGATGAGATGATGAAGTGGGTA
rJMSF030C02+ ACTGGGAAGCATCCCTCAGAACACCCAGTTCTAATGCCGGATGAGATGATGAAGTGGGTA
rJMFF030I03+ ACTGGGAAGCATCCCTCAGAACACCCAGTTCTAATGCCGGATGAGATGATGAAGTGGGTA
JMFS020E11+ ACTGGGAATCATCCCTCAGAACACCCAGTTCTAATGCCGGATGAGATGATGAAGTGGGTA
rJMFF007K24+ ACTGGGAAGCATCCCTCAGAACACCCAGTTCTAATGCCGGATGAGATGATGAAGTGGGTA
                      ____________________________________________________________
consensus ACTGGGAAGCATCCCTCAGAACACCCAGTTCTAATGCCGGATGAGATGATGAAGTGGGTA
 
. : . : . : . : . : . :
rJMSF052G17+ AGGTCCACCAGGGACGATGATGATGGCAGAGAAGAAAACGGCATTAGGCTGGGAATGATT
rJMSF030C02+ AGGTCCACCAGGGACGATGATGATGGCAGAGAAGAAAACGGCATTAGGCTGGGAATGATT
rJMFF030I03+ AGGTCCACCAGGGACGATGATGATGGCAGAGAAGAAAACGGCATTAGGCTGGGAATGATT
JMFS020E11+ AGGTCCACCAGGGACGATGATGATGGCAGAGAAGAAAACGGCATTAGGCTGGGAATGATT
rJMFF007K24+ AGGTCCACCAGGGACGATGATGATGGCAGAGAAGAAAACGGCATTAGGCTGGGAATGATT
                      ____________________________________________________________
consensus AGGTCCACCAGGGACGATGATGATGGCAGAGAAGAAAACGGCATTAGGCTGGGAATGATT
 
. : . : . : . : . : . :
rJMSF052G17+ CTTGAAGTGGCAATGGTGTGCAGTGTGGCGTCCCCAGAGCAAAGACCGACCATGTGGCAA
rJMSF030C02+ CTTGAAGTGGCAATGGTGTGCAGTGTGGCGTCCCCAGAGCAAAGACCGACCATGTGGCAA
rJMFF030I03+ CTTGAAGTGGCAATGGTGTGCAGTGTGGCGTCCCCAGAGCAAAGACCGACCATGTGGCAA
JMFS020E11+ CTTGAAGTGGCAATGGTGTGCAGTGTGGCGTCCCCAGAGCAAAGACCGACCATGTGGCAA
rJMFF007K24+ CTTGAAGTGGCAATGGTGTGCAGTGTGGCGTCCCCAGAGCAAAGACCGACCATGTGGCAA
                      ____________________________________________________________
consensus CTTGAAGTGGCAATGGTGTGCAGTGTGGCGTCCCCAGAGCAAAGACCGACCATGTGGCAA
 
. : . : . : . : . : . :
rJMSF052G17+ GTGTTGAAGATGATCCAGGAGATCAAAGATGCCGCCATTATGGAGGAGGATGGTCGGGAA
rJMSF030C02+ GTGTTGAAGATGATCCAGGAGATCAAAGATGCCGCCATTATGGAGGAGGATGGTCGGGAA
rJMFF030I03+ GT-TTGAAGATGATCCAGGAGATCAAAGATGCCGCCATTATGGAGGAGGATGGTCGGGAA
JMFS020E11+ GTGTTGAAGATGATCCAGGAGATCAAAGATGCCGCCATTATGGAGGAGGATGGTCGGGAA
rJMFF007K24+ GTGTTGAAGATGATCCAGGAGATCAAAGATGCCGCCATTATGGAGGAGGATGGTCGGGAA
                      ____________________________________________________________
consensus GTGTTGAAGATGATCCAGGAGATCAAAGATGCCGCCATTATGGAGGAGGATGGTCGGGAA
 
. : . : . : . : . : . :
rJMSF052G17+ ATGGACCTACTCACCGGGACTTGACTCTTCAGCATATACTATTATTATTTTTGCTA
rJMSF030C02+ ATGGACCTACTCACCGGGACTTGACTCTTCAGCATATACTATTATTATTTTTGCTATGTA
rJMFF030I03+ ATGGACCTACTCACCGGGACTTGACTCTTCAGCATATACTATTATTATTTTTGCTATGTA
JMFS020E11+ ATGGACCTACTCACCGGGACTTGACTCTTCAGCATATACTATTATTATTTTTGCTATGTA
rJMFF007K24+ ATGGACCTACTCACCGGGACTTGACTCTTCAGCATATACTATTATTATTTTTGCTATGTA
                      ____________________________________________________________
consensus ATGGACCTACTCACCGGGACTTGACTCTTCAGCATATACTATTATTATTTTTGCTATGTA
 
. : . : . : . : . : . :
rJMSF030C02+ TATA
rJMFF030I03+ TATA
JMFS020E11+ TATATACTTGAGCATGGCGACATAACTTTTCCACACAAA
rJMFF007K24+ TATATACTTGAGCATGGCGACATAACTTTTCCACACAAACCCTCTCTAATTCTTCCCTTC
                      ____________________________________________________________
consensus TATATACTTGAGCATGGCGACATAACTTTTCCACACAAACCCTCTCTAATTCTTCCCTTC
 
. : . : . : . : . : . :
rJMFF007K24+ CATTCTTTACTAAAGTAGCACAAGTGTTTTGCTTTCTTTTTTAGTACGTCCAAAGTTTAT
                      ____________________________________________________________
consensus CATTCTTTACTAAAGTAGCACAAGTGTTTTGCTTTCTTTTTTAGTACGTCCAAAGTTTAT