Previous Contig 008507:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001M13Sequence486000042 (5)gb:AY057485_15639041e-09Arabidopsis thaliana AT3g08680/F17O14_15 mRNA, complete cds.>gb:BT000497_1634775677008507 (5)pir|T05606|T056065e-57protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara
JMFF003L15Sequence535000042 (5)pir|T05606|T056064e-36protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara695008507 (5)pir|T05606|T056062e-57protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara
JMFF004I18Sequence662000042 (5)pir|T05606|T056066e-34protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara704008507 (5)pir|T05606|T056061e-62protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara
JMFF007K21Sequence575000042 (5)pir|T05606|T056064e-44protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara699008507 (5)pir|T05606|T056062e-57protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara
JMFF027F19Sequence402000042 (5)pir|T05606|T056066e-11protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara655008507 (5)pir|T05606|T056068e-52protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF004I18+ CGGGA
                      ____________________________________________________________
consensus CGGGA
 
. : . : . : . : . : . :
rJMFF004I18+ ACATCAAGTCCTCGAACATCTTTCTGAACTCAAAGCAATACGGGTGCGTATCCGATGTGG
rJMFF003L15+ TGAACTCAAAGCAATACGGGTGCGTATCCGATGTGG
rJMFF001M13+ TGAACTCAAAGCAATACGGGTGCGTATCCGATGTGG
rJMFF007K21+ TGAACTCAAAGCAATACGGGTGCGTATCCGATGTGG
                      ____________________________________________________________
consensus ACATCAAGTCCTCGAACATCTTTCTGAACTCAAAGCAATACGGGTGCGTATCCGATGTGG
 
. : . : . : . : . : . :
rJMFF004I18+ GTCTGTCAGCAATAATGAGCTCGTTGGCTCCGCCAGTAGCTCGTGCTGCTGGGTACCGAG
rJMFF027F19+ TCTGTCAGCAATAATGAGCTCGTTGGCTCCGCCAGTAGCTCGTGCTGCTGGGTACCGAG
rJMFF003L15+ GTCTGTCAGCAATAATGAGCTCGTTGGCTCCGCCAGTAGCTCGTGCTGCTGGGTACCGAG
rJMFF001M13+ GTCTGTCAGCAATAATGAGCTCGTTGGCTCCGCCAGTAGCTCGTGCTGCTGGGTACCGAG
rJMFF007K21+ GTCTGTCAGCAATAATGAGCTCGTTGGCTCCGCCAGTAGCTCGTGCTGCTGGGTACCGAG
                      ____________________________________________________________
consensus GTCTGTCAGCAATAATGAGCTCGTTGGCTCCGCCAGTAGCTCGTGCTGCTGGGTACCGAG
 
. : . : . : . : . : . :
rJMFF004I18+ CCCCAGAAGTGGTGGACACGCGAAAAGCAGCACACCCTTCGGACGTCTACAGCTTTGGAG
rJMFF027F19+ CCCCAGAAGTGGTGGACACGCGAAAAGCAGCACACCCTTCGGACGTCTACAGCTTTGGAG
rJMFF003L15+ CCCCAGAAGTGGTGGACACGCGAAAAGCAGCACACCCTTCGGACGTCTACAGCTTTGGAG
rJMFF001M13+ CCCCAGAAGTGGTGGACACGCGAAAAGCAGCACACCCTTCGGACGTCTACAGCTTTGGAG
rJMFF007K21+ CCCCAGAAGTGGTGGACACGCGAAAAGCAGCACACCCTTCGGACGTCTACAGCTTTGGAG
                      ____________________________________________________________
consensus CCCCAGAAGTGGTGGACACGCGAAAAGCAGCACACCCTTCGGACGTCTACAGCTTTGGAG
 
. : . : . : . : . : . :
rJMFF004I18+ TGCTGTTGCTCGAGCTCCTGACCGGGAAATCCCCCGTCCACACCACGAGCGGGGACGAGA
rJMFF027F19+ TGCTGTTGCTCGAGCTCCTGACCGGGAAATCCCCCGTCCACACCACGAGCGGGGACGAGA
rJMFF003L15+ TGCTGTTGCTCGAGCTCCTGACCGGGAAATCCCCCGTCCACACCACGAGCGGGGACGAGA
rJMFF001M13+ TGCTGTTGCTCGAGCTCCTGACCGGGAAATCCCCCGTCCACACCACGAGCGGGGACGAGA
rJMFF007K21+ TGCTGTTGCTCGAGCTCCTGACCGGGAAATCCCCCGTCCACACCACGAGCGGGGACGAGA
                      ____________________________________________________________
consensus TGCTGTTGCTCGAGCTCCTGACCGGGAAATCCCCCGTCCACACCACGAGCGGGGACGAGA
 
. : . : . : . : . : . :
rJMFF004I18+ TCATCCACCTGGTGCGGTGGGTGCACTCGGTGGTCCGGGAGGAGTGGACTGCTGAAGTGT
rJMFF027F19+ TCATCCACCTGGTGCGGTGGGTGCACTCGGTGGTCCGGGAGGAGTGGACTGCTGAAGTGT
rJMFF003L15+ TCATCCACCTGGTGCGGTGGGTGCACTCGGTGGTCCGGGAGGAGTGGACTGCTGAAGTGT
rJMFF001M13+ TCATCCACCTGGTGCGGTGGGTGCACTCGGTGGTCCGGGAGGAGTGGACTGCTGAAGTGT
rJMFF007K21+ TCATCCACCTGGTGCGGTGGGTGCACTCGGTGGTCCGGGAGGAGTGGACTGCTGAAGTGT
                      ____________________________________________________________
consensus TCATCCACCTGGTGCGGTGGGTGCACTCGGTGGTCCGGGAGGAGTGGACTGCTGAAGTGT
 
. : . : . : . : . : . :
rJMFF004I18+ TTGATGTGAAGCTGCTGAAGATCCCAGACATAGAGGAAGAGATGGTGGAGATGTTGCAGA
rJMFF027F19+ TTGATGTGAAGCTGCTGAAGATCCCAGACATAGAGGAAGAGATGGTGGAGATGTTGCAGA
rJMFF003L15+ TTGATGTGAAGCTGCTGAAGATCCCAGACATAGAGGAAGAGATGGTGGAGATGTTGCAGA
rJMFF001M13+ TTGATGTGAAGCTGCTGAAGATCCCAGACATAGAGGAAGAGATGGTGGAGATGTTGCAGA
rJMFF007K21+ TTGATGTGAAGCTGCTGAAGATCCCAGACATAGAGGAAGAGATGGTGGAGATGTTGCAGA
                      ____________________________________________________________
consensus TTGATGTGAAGCTGCTGAAGATCCCAGACATAGAGGAAGAGATGGTGGAGATGTTGCAGA
 
. : . : . : . : . : . :
rJMFF004I18+ TTGCTCTGTCGTGTGTGGTCAGGATGCCGGATCAGAGACCCAAAATGCCAGAAGTTGTTA
rJMFF027F19+ TTGCTCTGTCGTGTGTGGTCAGGATGCCGGATCAGAGACCCAAAATGCCAGAAGTTGTTA
rJMFF003L15+ TTGCTCTGTCGTGTGTGGTCAGGATGCCGGATCAGAGACCCAAAATGCCAGAAGTTGTTA
rJMFF001M13+ TTGCTCTGTCGTGTGTGGTCAGGATGCCGGATCAGAGACCCAAAATGCCAGAAGTTGTTA
rJMFF007K21+ TTGCTCTGTCGTGTGTGGTCAGGATGCCGGATCAGAGACCCAAAATGCCAGAAGTTGTTA
                      ____________________________________________________________
consensus TTGCTCTGTCGTGTGTGGTCAGGATGCCGGATCAGAGACCCAAAATGCCAGAAGTTGTTA
 
. : . : . : . : . : . :
rJMFF004I18+ AAATGATCGAAGGCGTGAGGAGGAACGATCATTTGGAGAACCGGAGATCTTGTGAAAATG
rJMFF027F19+ AAATGATCGAAGGCGTGAGGAGGAACGATCATTTGGAGAACCGGAGATCTTGTGAAAATG
rJMFF003L15+ AAATGATCGAAGGCGTGAGGAGGAACGATCATTTGGAGAACCGGAGATCTTGTGAAAATG
rJMFF001M13+ AAATGATCGAAGGCGTGAGGAGGAACGATCATTTGGAGAACCGGAGATCTTGTGAAAATG
rJMFF007K21+ AAATGATCGAAGGCGTGAGGAGGAACGATCATTTGGAGAACCGGAGATCTTGTGAAAATG
                      ____________________________________________________________
consensus AAATGATCGAAGGCGTGAGGAGGAACGATCATTTGGAGAACCGGAGATCTTGTGAAAATG
 
. : . : . : . : . : . :
rJMFF004I18+ GCGCATCGAGGCTGTCACCATCCTCGATTGAGCAGGAATGCTCTTAGAATCTGCAGAATT
rJMFF027F19+ GCGCATCGAGGCTGTCACCATCCTCGATTGAGCAGGAATGCTCTTAGAATCTGCAGAATT
rJMFF003L15+ GCGCATCGAGGCTGTCACCATCCTCGATTGAGCAGGAATGCTCTTAGAATCTGCAGAATT
rJMFF001M13+ GCGCATCGAGGCTGTCACCATCCTCGATTGAGCAGGAATGCTCTTAGAATCTGCAGAATT
rJMFF007K21+ GCGCATCGAGGCTGTCACCATCCTCGATTGAGCAGGAATGCTCTTAGAATCTGCAGAATT
                      ____________________________________________________________
consensus GCGCATCGAGGCTGTCACCATCCTCGATTGAGCAGGAATGCTCTTAGAATCTGCAGAATT
 
. : . : . : . : . : . :
rJMFF004I18+ GAATGAAGAAGTTGAAGTGATTCATGTCCCACATTGTTGCCATCTAGCTTTAATTTTAAT
rJMFF027F19+ GAATGAAGAAGTTGAAGTGATTCATGTCCCACATTGTTGCCATCTAGCTTTAATTTTAAT
rJMFF003L15+ GAATGAAGAAGTTGAGGTGATTCATGTCCCACATTGTTGCCATCTAGCTTTAATTTTAAT
rJMFF001M13+ GAATGAAGAAGTTGAAGTGATTCATGTCCCACATTGTTGCCATCTAGCTTTAATTTTAAT
rJMFF007K21+ GAATGAAGAAGTTGAGGTGATTCATGTCCCACATTGTTGCCATCTAGCTTTAATTTTAAT
                      ____________________________________________________________
consensus GAATGAAGAAGTTGAAGTGATTCATGTCCCACATTGTTGCCATCTAGCTTTAATTTTAAT
 
. : . : . : . : . : . :
rJMFF004I18+ CTGATTCCAGCGGTGTTTAAATGTATATTCACTATCTCAGTGGAGTCCGGGGATTCTTCT
rJMFF027F19+ CTGATTCCAGCGGTGTTTAAATGTATATTCACTATCTCAGTGGAGTCCGGGGATTCTTCT
rJMFF003L15+ CTGATTCCAGCGGTGTTTAAATGTATATTCACTATCTCAGTGGAGTCCGGGGATTCTTCT
rJMFF001M13+ CTGATTCCAGCGGTGTTTAAATGTATATTCACTATCTCAGTGGAGTCCGGGGATTCTTCT
rJMFF007K21+ CTGATTCCAGCGGTGTTTAAATGTATATTCACTATCTCAGTGGAGTCCGGGGATTCTTCT
                      ____________________________________________________________
consensus CTGATTCCAGCGGTGTTTAAATGTATATTCACTATCTCAGTGGAGTCCGGGGATTCTTCT
 
. : . : . : . : . : . :
rJMFF004I18+ TTGTAATAATCTGATGATCACAGTACAGTAAT
rJMFF027F19+ TTGTAATAATCTGATGATCACAGTACAGTAATTGCAGAGATGGACTTGTTAAGCTA
rJMFF003L15+ TTGTAATAATCTGATGATCACAGTACAGTAATTGCAGAGATGGACTTGTTAAGCTA
rJMFF001M13+ TTGTAATAATCTGATGATCACAGTACAGTAAT
rJMFF007K21+ TTGTAATAATCTGATGATCACAGTACAGTAATTGCAGAGATGGACTTGTTAAGCTATGAT
                      ____________________________________________________________
consensus TTGTAATAATCTGATGATCACAGTACAGTAATTGCAGAGATGGACTTGTTAAGCTATGAT