Previous Contig 008505:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007K08Sequence408008505 (2)gb:BT010830_16407763e-33Arabidopsis thaliana At1g09580 mRNA, complete cds.792008505 (2)gb:BT010830_16407764e-69Arabidopsis thaliana At1g09580 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007K08- A
                      ____________________________________________________________
consensus A
 
. : . : . : . : . : . :
JMFF007K08- TAAACATCTACTGTATATACAGTGAGATTCCGGGAAGGAAATGATGGTGGAAAATGCTGC
rJMFF007K08+ GGAAAATGCTGC
                      ____________________________________________________________
consensus TAAACATCTACTGTATATACAGTGAGATTCCGGGAAGGAAATGATGGTGGAAAATGCTGC
 
. : . : . : . : . : . :
JMFF007K08- GAGCCTGCGCGGATGGGCGATGTGGGCACTGCCATTGATGACGTTGTCTTTGTGGTTAGA
rJMFF007K08+ GAGCNTGCGCGGATGGGCGATGTGGGCACTGCCATTGATGACGTTGTCTTTGTGGTTAGA
                      ____________________________________________________________
consensus GAGCCTGCGCGGATGGGCGATGTGGGCACTGCCATTGATGACGTTGTCTTTGTGGTTAGA
 
. : . : . : . : . : . :
JMFF007K08- GATGGGAGAGGCCATATGGTTAAATCTGCCCGGGAGCGGCACCAAATGCGTGTCGGAGGA
rJMFF007K08+ GATGGGAGAGGCCATATGGTTAAATCTGCCCGGGAGCGGCACCAAATGCGTGTCGGAGGA
                      ____________________________________________________________
consensus GATGGGAGAGGCCATATGGTTAAATCTGCCCGGGAGCGGCACCAAATGCGTGTCGGAGGA
 
. : . : . : . : . : . :
JMFF007K08- AATTCACAACAACGTCGTCGTCTTGGCCGACTACGTCGTCATTTCCGACGATCATGTCCA
rJMFF007K08+ AATTCACAACAACGTCGTCGTCTTGGCCGACTACGTCGTCATTTCCGACGATCATGTCCA
                      ____________________________________________________________
consensus AATTCACAACAACGTCGTCGTCTTGGCCGACTACGTCGTCATTTCCGACGATCATGTCCA
 
. : . : . : . : . : . :
JMFF007K08- CCCCACTCCCACCATCTCCGTCAAGGTAACGTCGCCATATGGAAACACCCTTCATTCAAA
rJMFF007K08+ CCCCACTCCCACCATCTCCGTCAAGGTAACGTCGCCATATGGAAACACCCTTCATTCAAA
                      ____________________________________________________________
consensus CCCCACTCCCACCATCTCCGTCAAGGTAACGTCGCCATATGGAAACACCCTTCATTCAAA
 
. : . : . : . : . : . :
JMFF007K08- TGAGAATGTGACACACGGCCAGTTTGCCTTCACAACTACTGAGGCCGGCAACTATCTAGC
rJMFF007K08+ TGAGAATGTGACACACGGCCAGTTTGCCTTCACAACTACTGAGGCCGGCAACTATCTAGC
                      ____________________________________________________________
consensus TGAGAATGTGACACACGGCCAGTTTGCCTTCACAACTACTGAGGCCGGCAACTATCTAGC
 
. : . : . : . : . : . :
JMFF007K08- TTGTTTCTGGGTTGATGGTCATAACCCTGGTGGTGGGGGGTTTAAGT
rJMFF007K08+ TTGTTTCTGGGTTGATGGTCATAACCCTGGTGGTGGGGGGTTTAAGTGTTAACCTCGATT
                      ____________________________________________________________
consensus TTGTTTCTGGGTTGATGGTCATAACCCTGGTGGTGGGGGGTTTAAGTGTTAACCTCGATT
 
. : . : . : . : . : . :
rJMFF007K08+ GGAAAACTGGAATTGCTGCAAAAGACTGGGAGTCAGTTGCAAGAAAGGAGAAAATAGAAG
                      ____________________________________________________________
consensus GGAAAACTGGAATTGCTGCAAAAGACTGGGAGTCAGTTGCAAGAAAGGAGAAAATAGAAG
 
. : . : . : . : . : . :
rJMFF007K08+ GCATTGAGCTTGAGTTAAGAAAGCTTGAAGGTGCAGTCGAGGCCATCCATGAAAATCTAC
                      ____________________________________________________________
consensus GCATTGAGCTTGAGTTAAGAAAGCTTGAAGGTGCAGTCGAGGCCATCCATGAAAATCTAC
 
. : . : . : . : . : . :
rJMFF007K08+ TATACTTAAAGACCAGAGAAGCAGAGATGCGGACAGTGAGCGAAACAACAAATTCTCGAG
                      ____________________________________________________________
consensus TATACTTAAAGACCAGAGAAGCAGAGATGCGGACAGTGAGCGAAACAACAAATTCTCGAG
 
. : . : . : . : . : . :
rJMFF007K08+ TGGCTTGGTTCAGTATCATGTCCTTGGGCGTCTGCATTGGGGTTTCGTTTCTGCAAATAT
                      ____________________________________________________________
consensus TGGCTTGGTTCAGTATCATGTCCTTGGGCGTCTGCATTGGGGTTTCGTTTCTGCAAATAT
 
. : . : . : . : . : . :
rJMFF007K08+ TGCATTTGAAGCAATTTTTCCAAAAGAAGAAGCTGATTTAGTCTGGCTTTTGCTAATCGT
                      ____________________________________________________________
consensus TGCATTTGAAGCAATTTTTCCAAAAGAAGAAGCTGATTTAGTCTGGCTTTTGCTAATCGT
 
. : . : . : . : . : . :
rJMFF007K08+ GTTTGTTAGGGCTCTTTCTTCTTTCGATTTTGTCACTTTCCTCGGAGGATTAAAATTTTG
                      ____________________________________________________________
consensus GTTTGTTAGGGCTCTTTCTTCTTTCGATTTTGTCACTTTCCTCGGAGGATTAAAATTTTG
 
. : . : . : . : . : . :
rJMFF007K08+ ATCTAACAGAAGCTTTGTTCAGCTTCTTCTGTATGTGATAATGAAGCACGTAAAGATGAG
                      ____________________________________________________________
consensus ATCTAACAGAAGCTTTGTTCAGCTTCTTCTGTATGTGATAATGAAGCACGTAAAGATGAG