Previous Contig 008501:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007J03Sequence527008501 (4)gb:OSJN00108_16950692e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque712008501 (4)gb:OSJN00108_16950693e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque
JMFF032C07Sequence524008501 (4)gb:OSJN00108_16950692e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque678008501 (4)gb:OSJN00108_16950693e-60Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0070J16, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF032C07- AGCGCTACCCTCCCATCCAAACCCTAAATCTCCGCATTTTCCACCGGGAATA
JMFF007J03- AGCGCTACCCTCCCATCCAAACCCTAAATCTCCGCATTTTCCACCGGGAATA
rJMFF032C07+ CTCCGCATTTTCCACCGGGAATA
rJMFF007J03+ AGCGCTACCCTCCCATCCAAACCCTAAATCTCCGCATTTTCCACCGGGAATA
                      ____________________________________________________________
consensus AGCGCTACCCTCCCATCCAAACCCTAAATCTCCGCATTTTCCACCGGGAATA
 
. : . : . : . : . : . :
JMFF032C07- GCTCGCTCTGCGCCTCCGCATAAACCGGCGCTCCTGCTCATTCCAGTAGACGAAAATGCC
JMFF007J03- GCTCGCTCTGCGCCTCCGCATAAACCGGCGCTCCTGCTCATTCCAGTAGACGAAAATGCC
rJMFF032C07+ GCTCGCTTTGCGCCTCCGCATAAACCGGCGCTCCTGCTCATTCCAGTAGACGAAAATGCC
rJMFF007J03+ GCTCGCTCTGCGCCTCCGCATAAACCGGCGCTCCTGCTCATTCCAGTAGACGAAAATGCC
                      ____________________________________________________________
consensus GCTCGCTCTGCGCCTCCGCATAAACCGGCGCTCCTGCTCATTCCAGTAGACGAAAATGCC
 
. : . : . : . : . : . :
JMFF032C07- GTTCAAGAGGTACGTTGAAATTGGAAGGGTCGCTCTCGTCAACTACGGAAAGGACTATGG
JMFF007J03- GTTCAAGAGGTACGTTGAAATTGGAAGGGTCGCTCTCGTCAACTACGGAAAGGACTATGG
rJMFF032C07+ GTTCAAGAGGTACGTTGAAATTGGAAGGGTCGCTCTCGTCAACTACGGAAAGGACTATGG
rJMFF007J03+ GTTCAAGAGGTACGTTGAAATTGGAAGGGTCGCTCTCGTCAACTACGGAAAGGACTATGG
                      ____________________________________________________________
consensus GTTCAAGAGGTACGTTGAAATTGGAAGGGTCGCTCTCGTCAACTACGGAAAGGACTATGG
 
. : . : . : . : . : . :
JMFF032C07- AAAGCTCGTCGTCATCGTCGATGTTATTGATCAGAACAGGGCACTTGTTGATGCCCCTGA
JMFF007J03- AAAGCTCGTCGTCATCGTCGATGTTATTGATCAGAACAGGGCACTTGTTGATGCCCCTGA
rJMFF032C07+ AAAGCTCGTCGTCATCGTCGATGTTATTGATCAGAACAGGGCACTTGTTGATGCCCCTGA
rJMFF007J03+ AAAGCTCGTCGTCATCGTCGATGTTATTGATCAGAACAGGGCACTTGTTGATGCCCCTGA
                      ____________________________________________________________
consensus AAAGCTCGTCGTCATCGTCGATGTTATTGATCAGAACAGGGCACTTGTTGATGCCCCTGA
 
. : . : . : . : . : . :
JMFF032C07- CATGGTACGGAGCCAAATGAACTTCAAAAGGCTTACACTCACAGATATAACAATTGACAT
JMFF007J03- CATGGTACGGAGCCAAATGAACTTCAAAAGGCTTACACTCACAGATATAACAATTGACAT
rJMFF032C07+ CATGGTACGGAGCCAAATGAACTTCAAAAGGCTTACACTCACAGATATAACAATTGACAT
rJMFF007J03+ CATGGTACGGAGCCAAATGAACTTCAAAAGGCTTACACTCACAGATATAACAATTGACAT
                      ____________________________________________________________
consensus CATGGTACGGAGCCAAATGAACTTCAAAAGGCTTACACTCACAGATATAACAATTGACAT
 
. : . : . : . : . : . :
JMFF032C07- AAAAAGGGTCCCGAAGAAGAAGACTTTGATTGCTGCCATGGAGGCTGCTGATGTCAAGAA
JMFF007J03- AAAAAGGGTCCCGAAGAAGAAGACTTTGATTGCTGCCATGGAGGCTGCTGATGTCAAGAA
rJMFF032C07+ AAAAAGGGTCCCGAAGAAGAAGACTTTGATTGCTGCCATGGAGGCTGCTGATGTCAAGAA
rJMFF007J03+ AAAAAGGGTCCCGAAGAAGAAGACTTTGATTGCTGCCATGGAGGCTGCTGATGTCAAGAA
                      ____________________________________________________________
consensus AAAAAGGGTCCCGAAGAAGAAGACTTTGATTGCTGCCATGGAGGCTGCTGATGTCAAGAA
 
. : . : . : . : . : . :
JMFF032C07- CAAGTGGGAGAACAGCTCCTGGGGCAGGAAGTTGATTGTGCAGAAGAGGAGGGCTGCTCT
JMFF007J03- CAAGTGGGAGAACAGCTCCTGGGGCAGGAAGTTGATTGTGCAGAAGAGGAGGGCTGCTCT
rJMFF032C07+ CAAGTGGGAGAACAGCTCCTGGGGCAGGAAGTTGATTGTGCAGAAGAGGAGGGCTGCTCT
rJMFF007J03+ CAAGTGGGAGAACAGCTCCTGGGGCAGGAAGTTGATTGTGCAGAAGAGGAGGGCTGCTCT
                      ____________________________________________________________
consensus CAAGTGGGAGAACAGCTCCTGGGGCAGGAAGTTGATTGTGCAGAAGAGGAGGGCTGCTCT
 
. : . : . : . : . : . :
JMFF032C07- AAATGATTTTGACAGGTTCAAGATCATGTTGGCAAAAATCAAGAAGGCTGGAATTGTGAG
JMFF007J03- AAATGATTTTGACAGGTTCAAGATCATGTTGGCAAAAATCAAGAAGGCTGGAATTGTGAG
rJMFF032C07+ AAATGATTTTGACAGGTTCAAGATCATGTTGGCAAAAATCAAGAAGGCTGGAATTGTGAG
rJMFF007J03+ AAATGATTTTGACAGGTTCAAGATCATGTTGGCAAAAATCAAGAAGGCTGGAATTGTGAG
                      ____________________________________________________________
consensus AAATGATTTTGACAGGTTCAAGATCATGTTGGCAAAAATCAAGAAGGCTGGAATTGTGAG
 
. : . : . : . : . : . :
JMFF032C07- ACAGGAGCTTTCAAAGCTTAAGAAGGAGAGCACAGCCTAAAATCCATTTTCT
JMFF007J03- ACAGGAGCTTTCAAAGCTTAAGAAGGAGAGCACAGCCTAAAATCCATTTTCT
rJMFF032C07+ ACAGGAGCTTTCAAAGCTTAAGAAGGAGAGCACAGCCTAAAATCCATTTTCTTATAATAT
rJMFF007J03+ ACAGGAGCTTTCAAAGCTTAAGAAGGAGAGCACAGCCTAAAATCCATTTTCTTATAATAT
                      ____________________________________________________________
consensus ACAGGAGCTTTCAAAGCTTAAGAAGGAGAGCACAGCCTAAAATCCATTTTCTTATAATAT
 
. : . : . : . : . : . :
rJMFF032C07+ TGATGTTCTTATATTAGGTCTTCTGCCTTGTATCAAGGATTGTCTCTTTAGTTTCTGCTT
rJMFF007J03+ TGATGTTCTTATATTAGGTCTTCTGCCTTGTATCAAGGATTGTCTCTTTAGTTTCTGCTT
                      ____________________________________________________________
consensus TGATGTTCTTATATTAGGTCTTCTGCCTTGTATCAAGGATTGTCTCTTTAGTTTCTGCTT
 
. : . : . : . : . : . :
rJMFF032C07+ CTCTTGTATCGAGAAAGACACAATTTTGTCATATCATTCATCATATGCATTTTTGGAAAC
rJMFF007J03+ CTCTTGTATCGAGAAAGACACAATTTTGTCATATCATTCATCATATGCATTTTTGGAAAC
                      ____________________________________________________________
consensus CTCTTGTATCGAGAAAGACACAATTTTGTCATATCATTCATCATATGCATTTTTGGAAAC
 
. : . : . : . : . : . :
rJMFF032C07+ TTTTTTGCGGTGGATCTTATGTTGATTGTTGAAATATTATCAAGCACCATAAAAT
rJMFF007J03+ TTTTTTGCGGTGGATCTTATGTTGATTGTTGAAATATTATCAAGCACCATAAAATTAAGT
                      ____________________________________________________________
consensus TTTTTTGCGGTGGATCTTATGTTGATTGTTGAAATATTATCAAGCACCATAAAATTAAGT