Previous Contig 008494:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007G03Sequence583008494 (6)gb:AY087773_15728004e-09Arabidopsis thaliana clone 38345 mRNA, complete sequence.731008494 (6)gb:AB016886_15131473e-53Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCA23.>gb:AK175664_1817
JMFF019J02Sequence536008494 (6)gb:AY087773_15728001e-16Arabidopsis thaliana clone 38345 mRNA, complete sequence.788008494 (6)gb:AB016886_15131477e-60Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCA23.>gb:AK175664_1817
JMFF030J17Sequence476008494 (6)gb:AY087773_15728005e-04Arabidopsis thaliana clone 38345 mRNA, complete sequence.332008494 (6)gb:AB016886_15131477e-21Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCA23.>gb:AK175664_1817

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007G03- ACCT
                      ____________________________________________________________
consensus ACCT
 
. : . : . : . : . : . :
JMFF030J17- ATAGGAAATGGAAAATTTCCGAAACAAACAGAAAGCCCACCTAACCGTCAGCTTGTAAAG
JMFF007G03- ATAGGAAATGGAAAATTTCCGAAACAAACAGAAAGCCCACCTAACCGTCAGCTTGTAAAG
                      ____________________________________________________________
consensus ATAGGAAATGGAAAATTTCCGAAACAAACAGAAAGCCCACCTAACCGTCAGCTTGTAAAG
 
. : . : . : . : . : . :
JMFF030J17- TCAGAGCTCTGAATCCACGTTTACCGCACTCCGATTCTCGGTCTGGTTTCAGAGCAGAGA
JMFF007G03- TCAGAGCTCTGAATCCACGTTTACCGCACTCCGATTCTCGGTCTGGTTTCAGAGCAGAGA
JMFF019J02- AGAGCTCTGAATCCACGTTTACCGCACTCCGATTCTCGGTCTGGTTTCAGAGCAGAGA
                      ____________________________________________________________
consensus TCAGAGCTCTGAATCCACGTTTACCGCACTCCGATTCTCGGTCTGGTTTCAGAGCAGAGA
 
. : . : . : . : . : . :
JMFF030J17- AATCCGTCTGAAATCGATCAGAAAATTCAGTGACAGAATGATCTCACGCTGCTCGAGCTG
JMFF007G03- AATCCGTCTGAAATCGATCAGAAAATTCAGTGACAGAATGATCTCACGCTGCTCGAGCTG
JMFF019J02- AATCCGTCTGAAATCGATCAGAAAATTCAGTGACAGAATGATCTCACGCTGCTCGAGCTG
rJMFF019J02+ TCGATCAGAAAATTCAGTGACAGAATGATCTCACGCTGCTCGAGCTG
                      ____________________________________________________________
consensus AATCCGTCTGAAATCGATCAGAAAATTCAGTGACAGAATGATCTCACGCTGCTCGAGCTG
 
. : . : . : . : . : . :
JMFF030J17- GAAGCTTCCGGTGGCGGAGGCGGGAGGGCCGCCGTTGCGTCTGCGGGCGAGGCAGGAAGG
JMFF007G03- GAAGCTTCCGGTGGCGGAGGCGGGGGGGCCGCCGTTGCGTCTGCGGGCGAGGCAGGAAGG
JMFF019J02- GAAGCTTCCGGTGGCGGAGGCGGGAGGGCCGCCGTTGCGTCTGCGGGCGAGGCAGGAAGG
rJMFF019J02+ GAAGCTTCCGGTGGCGGAGGCGGGAGGGCCGCCGTTGCGTCTGCGGGCGAGGCAGGAAGG
                      ____________________________________________________________
consensus GAAGCTTCCGGTGGCGGAGGCGGGAGGGCCGCCGTTGCGTCTGCGGGCGAGGCAGGAAGG
 
. : . : . : . : . : . :
JMFF030J17- AGTTCATTTCAGTAGGATTGCTACGAGGAGCTGCCCTGGCCCTGCTCCTAGCAGAGCGTT
JMFF007G03- AGTTCATTTCAGTAGGATTGCTACGAGGAGCTGCCCTGGCCCTGCTCCTAGCAGAGCGTT
JMFF019J02- AGTTCATTTCAGTAGGATTGCTACGAGGAGCTGCCCTGGCCCTGCTCCTAGCAGAGCGTT
rJMFF019J02+ AGTTCATTTCAGTAGGATTGCTACGAGGAGCTGCCCTGGCCCTGCTCCTAGCAGAGCGTT
rJMFF007G03+ TAGCAGAGCGTT
                      ____________________________________________________________
consensus AGTTCATTTCAGTAGGATTGCTACGAGGAGCTGCCCTGGCCCTGCTCCTAGCAGAGCGTT
 
. : . : . : . : . : . :
JMFF030J17- GAAGTTGCGTGT-GGCGGCGGTGGACCGCAG-CAGT-AACGGCGGCGCCGGTGAGAGCGC
JMFF007G03- GAAGTTGCGTGTGGGCGGCGGTGGACCGCAGCAAGT-AACGGCGGCGCCGGTGAGAGCGC
JMFF019J02- GAAGTTGCGTGTGGGCGGCGGTGGACCGCAGCCAGT-AACGGCGGCGCCGGTGAGAGCGC
rJMFF019J02+ GAAGTTGCGTGT-GGCGGCGGTGGACCGCAG-CAGT-AACGGCGGCGCCGGTGAGAGCGC
rJMFF007G03+ GAAGTTGCGTGT-GGCGGCGGTGGACCGCAG-CAGTAAACGGCGGCGCCGGNGAGAGCGC
                      ____________________________________________________________
consensus GAAGTTGCGTGT-GGCGGCGGTGGACCGCAG-CAGT-AACGGCGGCGCCGGTGAGAGCGC
 
. : . : . : . : . : . :
JMFF030J17- CGCCAGTAAG-AAGGCTGCTGCGTCCTCATCGTCGGTTCCTAATTCGAATTACATGGTGC
JMFF007G03- CGCCAGTAAN-AAGGCTGCTGCGTCCTCATCGTCGGTTCCTAATTCNAATTACATGGTGC
JMFF019J02- CGCCAGTAAG-AAGGCTGCTGCGTCCTCATCGTCGGTTCCTAATTCNAATTACATGGTGC
rJMFF019J02+ CGCCAGTAAG-AAGGCTGCTGCGTCCTCATCGTCGGTTCCTAATTCGAATTACATGGTGC
rJMFF007G03+ CGCCAGTAAGAAAGGCTGCTGCGTCCTCATCGTCGGTTCCTAATTCGAATTACATGGTGC
                      ____________________________________________________________
consensus CGCCAGTAAG-AAGGCTGCTGCGTCCTCATCGTCGGTTCCTAATTCGAATTACATGGTGC
 
. : . : . : . : . : . :
JMFF030J17- CGCTGGACAAGTCGTCTTCCTGCATTACTCGCCCCCTGGCCGAGATCCTCCGTGAC
JMFF007G03- CGCTGGACAANTCNTCTTCCTGCATTACTCNCCCCCTGGCCGANATCCTCCGTGACCTCA
JMFF019J02- CGCTGGACAAGTCGTCTTCCTGCATTACTCGCCCCCTGGCCGAGATCCTCCGTGACCTCA
rJMFF019J02+ CGCTGGACAAGTCGTCTTCCTGCATTACTCGCCCCCTGGCCGAGATCCTCCGTGACCTCA
rJMFF007G03+ CGCTGGACAAGTCGTCTTCCTGCATTACTCGCCCCCTGGCCGAGATCCTCCGTGACCTCA
                      ____________________________________________________________
consensus CGCTGGACAAGTCGTCTTCCTGCATTACTCGCCCCCTGGCCGAGATCCTCCGTGACCTCA
 
. : . : . : . : . : . :
JMFF007G03- ACAANANGATCCCCNATAACATCATCAAGGATCACNACNGNGATGATCCTCATGCCATAT
JMFF019J02- ACAANAGGATCCCCGATAACATCATCAAGGATCACNACAGTGATGATCCTCATGCCATAT
rJMFF019J02+ ACAAGAGGATCCCCGATAACATCATCAAGGATCACGACAGTGATGATCCTCATGCCATAT
rJMFF007G03+ ACAAGAGGATCCCCGATAACATCATCAAGGATCACGACAGTGATGATCCTCATGCCATAT
                      ____________________________________________________________
consensus ACAAGAGGATCCCCGATAACATCATCAAGGATCACGACAGTGATGATCCTCATGCCATAT
 
. : . : . : . : . : . :
JMFF007G03- TCATCCCCTGGTATCACNCCNATCNCATGTTGANCTTCTAC
JMFF019J02- TCATCCCCTGGTATCACNCCNATCNCATGTTGAGCTTCTACNCTCCANGTTGGTGCGGA
rJMFF019J02+ TCATCCCCTGGTATCACGCCAATCGCATGTTGAGCTTCTACGCTCCAGGTTGGTGCGGAG
rJMFF007G03+ TCATCCCCTGGTATCACGCCAATCGCATGTTGAGCTTCTACGCTCCAGGTTGGTGCGGAG
                      ____________________________________________________________
consensus TCATCCCCTGGTATCACGCCAATCGCATGTTGAGCTTCTACGCTCCAGGTTGGTGCGGAG
 
. : . : . : . : . : . :
rJMFF019J02+ AAATAAGGAATGTTATTTTCTCTGAGAATGGAACTGTGACTGTTGTTTACCGTGTCACTA
rJMFF030J17+ CTGTTGTTTACCGTGTCACTA
rJMFF007G03+ AAATAAGGAATGTTA-TTTCTCTGAGAATGGAACTGTGACTGTTGTTTACCGTGTCACTA
                      ____________________________________________________________
consensus AAATAAGGAATGTTATTTTCTCTGAGAATGGAACTGTGACTGTTGTTTACCGTGTCACTA
 
. : . : . : . : . : . :
rJMFF019J02+ TACTAGGATCGGATGGAGAGGCATACCGTGAATCAACCGGGACAGTATCATCAGGCGATG
rJMFF030J17+ TACTAGGATCGGATGGAGAGGCATACCGTGAATCAACCGGGACAGTATCATCAGGCGATG
rJMFF007G03+ TACTAGGATCGGATGGAGAGGCATACCGTGAATCAACCGGGACAGTATCATCAGGCGATG
                      ____________________________________________________________
consensus TACTAGGATCGGATGGAGAGGCATACCGTGAATCAACCGGGACAGTATCATCAGGCGATG
 
. : . : . : . : . : . :
rJMFF019J02+ AGCACATCAAGGATCCGGTCGCTGAAGCTGAGGAGATTGCTTTTTGCCGAGCATGTGCTC
rJMFF030J17+ AGCACATCAAGGATCCGGTCGCTGAAGCTGAGGAGATTGCTTTTTGCCGAGCATGTGCTC
rJMFF007G03+ AGCACATCAAGGATCCGGTCGCTGAAGCTGAGGAGATTGCTTTTTGCCGAGCATGTGCTC
                      ____________________________________________________________
consensus AGCACATCAAGGATCCGGTCGCTGAAGCTGAGGAGATTGCTTTTTGCCGAGCATGTGCTC
 
. : . : . : . : . : . :
rJMFF019J02+ GGTTTGGACTTGGCTTATATCTTTATCATGACGAGTAGCTGCTACAGAAATGACAATTTT
rJMFF030J17+ GGTTTGGACTTGGCTTATATCTTTATCATGACGAGTAGCTGCTACAGAAATGACAATTTT
rJMFF007G03+ AGTTTGGACTTGGCTTATATCTTTATCATGATGAGTAGCTGCTACAGAAATGACAATTTT
                      ____________________________________________________________
consensus GGTTTGGACTTGGCTTATATCTTTATCATGACGAGTAGCTGCTACAGAAATGACAATTTT
 
. : . : . : . : . : . :
rJMFF019J02+ GATAAGATGGATGAAGCAGTTTTATCTGCGTTCATAAGATATTTTAGTCTGGTATAAATA
rJMFF030J17+ GATAAGATGGATGAAGCAGTTTTATCTGCGTTCATAAGATATTTTAGTCTGGTATAAATA
rJMFF007G03+ GATAAGATGGATGAAGCAGTTTTATCTGCGTTCATAAGATATTTTAGTCTGGTATAAATA
                      ____________________________________________________________
consensus GATAAGATGGATGAAGCAGTTTTATCTGCGTTCATAAGATATTTTAGTCTGGTATAAATA
 
. : . : . : . : . : . :
rJMFF019J02+ ACCTTTAAAGCCGTCTGTATCACCA
rJMFF030J17+ ACCTTTAAAGCCGTCTGTATCACCACATTATACTACATATTCCACTATGACTTTTCATGT
rJMFF007G03+ ACCTTTAAAGCCGTCTGTATCACCACATTATACTACATATTCCACTATGACTTTTCATGT
                      ____________________________________________________________
consensus ACCTTTAAAGCCGTCTGTATCACCACATTATACTACATATTCCACTATGACTTTTCATGT
 
. : . : . : . : . : . :
rJMFF030J17+ GTTCTTGCTAC
rJMFF007G03+ GTTCTTGCTACTGGTTTATGTGCTGGAATTCTACCAGTTTTGCTAATTCTCACTTCCCAT
                      ____________________________________________________________
consensus GTTCTTGCTACTGGTTTATGTGCTGGAATTCTACCAGTTTTGCTAATTCTCACTTCCCAT