Previous Contig 008493:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007G02Sequence514008493 (4)gb:AY088365_15733852e-20Arabidopsis thaliana clone 620 mRNA, complete sequence.692008493 (4)gb:AC084818_17338503e-63Oryza sativa (japonica cultivar-group) chromosome 5 clone P0668H12, complete seq
JMSF038J07Sequence678008493 (4)gb:AY088365_15733852e-35Arabidopsis thaliana clone 620 mRNA, complete sequence.875008493 (4)gb:AC084818_17338504e-75Oryza sativa (japonica cultivar-group) chromosome 5 clone P0668H12, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007G02- GTCTTGACTCCTCCGCCGCTTATCGTCTTCGTCCCTTCACGTCTCCTCTCCAACA
JMSF038J07- GGTCTTGACTCCTCCGCCGCTTATCGTCTTCGTCCCTTCACGTCTCCTCTCCAACA
                      ____________________________________________________________
consensus GGTCTTGACTCCTCCGCCGCTTATCGTCTTCGTCCCTTCACGTCTCCTCTCCAACA
 
. : . : . : . : . : . :
JMFF007G02- ACACTCATTCACCTGTAGAAGAAGAAAGCCCTAAATCTCTTGCAACAATGGCGCTTCCTT
JMSF038J07- ACACTCATTCACCTGTAGAAGAAGAAAGCCCTAAATCTCTTGCAACAATGGCGCTTCCTT
                      ____________________________________________________________
consensus ACACTCATTCACCTGTAGAAGAAGAAAGCCCTAAATCTCTTGCAACAATGGCGCTTCCTT
 
. : . : . : . : . : . :
JMFF007G02- TTGCAGCACTTGCGAACGCTGGCTCCCTCTCAGTTCCGCGAAATCTCGCACCAGTCAAGG
JMSF038J07- TTGCAGCACTTGCGAACGCTGGCTCCCTCTCAGTTCCGCGAAATCTCGCACCAGTCAAGG
                      ____________________________________________________________
consensus TTGCAGCACTTGCGAACGCTGGCTCCCTCTCAGTTCCGCGAAATCTCGCACCAGTCAAGG
 
. : . : . : . : . : . :
JMFF007G02- TTTCAAGCTCTATGTGCTCGTACTCGAAGCTTCCGAGATCCAATTCGGCGGAAGATACGA
JMSF038J07- TTTCAAGCTCTATGTGCTCGTACTCGAAGCTTCCGAGATCCAATTCGGCGGAAGATACGA
                      ____________________________________________________________
consensus TTTCAAGCTCTATGTGCTCGTACTCGAAGCTTCCGAGATCCAATTCGGCGGAAGATACGA
 
. : . : . : . : . : . :
JMFF007G02- CGTCTTCTCTATCTTCTTTCTCTTCATCGGCCTTCTTCTCGGGCTCGTTACGTCTCCAAA
JMSF038J07- CGTCTTCTCTATCTTCTTTCTCTTCATCGGCCTTCTTCTCGGGCTCGTTACGTCTCCAAA
                      ____________________________________________________________
consensus CGTCTTCTCTATCTTCTTTCTCTTCATCGGCCTTCTTCTCGGGCTCGTTACGTCTCCAAA
 
. : . : . : . : . : . :
JMFF007G02- AATTTTCCAGTTGCTCAGTTCAAGTTAAATCCGGCCGTCCACTTGCTCCTGTTCGAGCAA
JMSF038J07- AATTTTCCAGTTGCTCAGTTCAAGTTAAATCCGGCCGTCCACTTGCTCCTGTTCGAGCAA
rJMSF038J07+ CTCCTGTTCGAGCAA
                      ____________________________________________________________
consensus AATTTTCCAGTTGCTCAGTTCAAGTTAAATCCGGCCGTCCACTTGCTCCTGTTCGAGCAA
 
. : . : . : . : . : . :
JMFF007G02- CTGCTCAGGTGGCTGAACCACAATCAAAAGTGACAAGCCAAGTTTATTTTGACATTAG-C
JMSF038J07- CTGCTCAGGTGGCTGAACCACAATCAAAAGTGACAAGCCAAGTTTATTTTGACATTAG-C
rJMSF038J07+ CTGCTCAGGTGGCTGAACCACAATCAAAAGTGACAAGCCAAGTTTATTTTGACATTAG-C
rJMFF007G02+ AGTGACAAGCCAAGTTTATTNTGACATTAGCC
                      ____________________________________________________________
consensus CTGCTCAGGTGGCTGAACCACAATCAAAAGTGACAAGCCAAGTTTATTTTGACATTAG-C
 
. : . : . : . : . : . :
JMFF007G02- ATTGGGAAT-CCTGTGGGAAAGGCTGCTGGGAGAATTGTGATTGGATTGTATGGAGATGA
JMSF038J07- ATTGGGAAT-CCTGTGGGAAAGGCTGCTGGGAGAATTGTGATTGGATTGTATGGAGATGA
rJMSF038J07+ ATTGGGAAT-CCTGTGGGAAAGGCTGCTGGGAGAATTGTGATTGGATTGTATGGAGATGA
rJMFF007G02+ ATTGGGAATCCCTGTNGGAAAGGCTGCTGGGAGAATTGTGATTGGATTNTATGGAGATGA
                      ____________________________________________________________
consensus ATTGGGAAT-CCTGTGGGAAAGGCTGCTGGGAGAATTGTGATTGGATTGTATGGAGATGA
 
. : . : . : . : . : . :
JMFF007G02- GGTGCCACAAACAGCTGAGAATTTCCGTGCT-CTATGCACAG
JMSF038J07- GGTGCCACAAACAGCTGAGAATTTCCGTGCT-CTATGCACAGGAGAGAAGGGC-TTTGGC
rJMSF038J07+ GGTGCCACAAACAGCTGAGAATTTCCGTGCT-CTATGCACAGGAGAGAAGGGC-TTTGGC
rJMFF007G02+ GGTGCCNCAAACAGNTGAGAATTTCCGTGCTCCTATGCACAGGAGAGAAGGGCTTTTGGC
                      ____________________________________________________________
consensus GGTGCCACAAACAGCTGAGAATTTCCGTGCT-CTATGCACAGGAGAGAAGGGC-TTTGGC
 
. : . : . : . : . : . :
JMSF038J07- TTCAAAGGCTCTAGTTTCCATCGTGTTATTAAGGACTTCATGATTCAAGGGGGTGACTTT
rJMSF038J07+ TTCAAAGGCTCTAGTTTCCATCGTGTTATTAAGGACTTCATGATTCAAGGGGGTGACTTT
rJMFF007G02+ TTCAAAGGCTNTAGTTTCCATCGTGTTATTAAGGACTTCATGATTCAAGGGGGTGACTTT
                      ____________________________________________________________
consensus TTCAAAGGCTCTAGTTTCCATCGTGTTATTAAGGACTTCATGATTCAAGGGGGTGACTTT
 
. : . : . : . : . : . :
JMSF038J07- GACAAGGGAAATGGAACTGGTGGTAAGAGCATATATGGTCGTACATTTAAAGATGAAAAC
rJMSF038J07+ GACAAGGGAAATGGAACTGGTGGTAAGAGCATATATGGTCGTACATTTAAAGATGAAAAC
rJMFF007G02+ GACAAGGGAAATGGAACTGGTGGTAAGAGCATATATGGTCGTACATTTAAAGATGAAAAC
                      ____________________________________________________________
consensus GACAAGGGAAATGGAACTGGTGGTAAGAGCATATATGGTCGTACATTTAAAGATGAAAAC
 
. : . : . : . : . : . :
JMSF038J07- TT
rJMSF038J07+ TTCAAGTTGGTTCATGCTGGACCTGGAGTTGTGAGCATGGCAAATGCAGGCCCCAACACA
rJMFF007G02+ TTCAAGTTGGTTCATGCTGGACCTGGAGTTGTGAGCATGGCAAATGCAGGCCCCAACACA
                      ____________________________________________________________
consensus TTCAAGTTGGTTCATGCTGGACCTGGAGTTGTGAGCATGGCAAATGCAGGCCCCAACACA
 
. : . : . : . : . : . :
rJMSF038J07+ AATGGAAGCCAGTTCTTCATATGCACTGTCAAGACACCATGGCTGGATAACAGGCATGTG
rJMFF007G02+ AATGGAAGCCAGTTCTTCATATGCACTGTCAAGACACCATGGCTGGATAACAGGCATGTG
                      ____________________________________________________________
consensus AATGGAAGCCAGTTCTTCATATGCACTGTCAAGACACCATGGCTGGATAACAGGCATGTG
 
. : . : . : . : . : . :
rJMSF038J07+ GTGTTTGGTCAAGTTATTGAGGGCATGGATGTGGTGAAGCTAATTGAATCACAGGAGACA
rJMFF007G02+ GTGTTTGGTCAAGTTATTGAGGGCATGGATGTGGTGAAGCTAATTGAATCACAGGAGACA
                      ____________________________________________________________
consensus GTGTTTGGTCAAGTTATTGAGGGCATGGATGTGGTGAAGCTAATTGAATCACAGGAGACA
 
. : . : . : . : . : . :
rJMSF038J07+ GACAGGGGTGATCGTCCTAAGAAGAGGGTTGTCATCAGTGATTGTGG
rJMFF007G02+ GACAGGGGTGATCGTCCTAAGAAGAGGGTTGTCATCAGTGATTGTGGTGAACTCCCAATT
                      ____________________________________________________________
consensus GACAGGGGTGATCGTCCTAAGAAGAGGGTTGTCATCAGTGATTGTGGTGAACTCCCAATT
 
. : . : . : . : . : . :
rJMFF007G02+ GTCTAAGCCTAAGCATAAATTCTGTCCTTTTAGTTACTATAGAGTACTACTAGTCTTCCC
                      ____________________________________________________________
consensus GTCTAAGCCTAAGCATAAATTCTGTCCTTTTAGTTACTATAGAGTACTACTAGTCTTCCC
 
. : . : . : . : . : . :
rJMFF007G02+ ATCAATAATAGTGTTGTGGGAAATCTCAAGGCTTTTTTTAATTCCAAGAATGATATTTGT
                      ____________________________________________________________
consensus ATCAATAATAGTGTTGTGGGAAATCTCAAGGCTTTTTTTAATTCCAAGAATGATATTTGT
 
. : . : . : . : . : . :
rJMFF007G02+ AGAAACTCTGTGAACTTTGAACTGGAATTCTAGATTTGTATGGCTTGTATCTGGGCCTAA
                      ____________________________________________________________
consensus AGAAACTCTGTGAACTTTGAACTGGAATTCTAGATTTGTATGGCTTGTATCTGGGCCTAA