Previous Contig 008489:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007E16Sequence655007516 (3)gb:AY039987_15604911e-32Arabidopsis thaliana putative transcription factor IIA large subunit (At1g07470)780008489 (3)gb:AY039987_15604916e-37Arabidopsis thaliana putative transcription factor IIA large subunit (At1g07470)
JMSF036O24Sequence220007516 (3)570008489 (3)gb:AY039987_15604918e-20Arabidopsis thaliana putative transcription factor IIA large subunit (At1g07470)
JMSF042N12Sequence794007516 (3)gb:AY039987_15604911e-32Arabidopsis thaliana putative transcription factor IIA large subunit (At1g07470)735008489 (3)gb:AY039987_15604915e-35Arabidopsis thaliana putative transcription factor IIA large subunit (At1g07470)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042N12+ GAGTGTTCAAGGTAGT
rJMFF007E16+ CCACAGCAAGATGGAGCTGGAGATGCATTATATTATGATCCAAAGAGTGTTCAAGGTAGT
                      ____________________________________________________________
consensus CCACAGCAAGATGGAGCTGGAGATGCATTATATTATGATCCAAAGAGTGTTCAAGGTAGT
 
. : . : . : . : . : . :
rJMSF042N12+ GCTATTCAGCATGGATCTGTTGCTGCTGGGAAGGAGATAGTGATAGAAGGGCTAAGTATT
rJMFF007E16+ GCTATTCAGCATGGATCTGTTGCTGCTGGGAAGGAGATAGTGATAGAAGGGCTAAGTATT
                      ____________________________________________________________
consensus GCTATTCAGCATGGATCTGTTGCTGCTGGGAAGGAGATAGTGATAGAAGGGCTAAGTATT
 
. : . : . : . : . : . :
rJMSF042N12+ TCAAGAATCCCTCAGCTGGATGGTCCAATTCCTGATCCTTATGATGAAATGCTCTCAACA
rJMFF007E16+ TCAAGAATCCCTCAGCTGGATGGTCCAATTCCTGATCCTTATGATGAAATGCTCTCAACA
                      ____________________________________________________________
consensus TCAAGAATCCCTCAGCTGGATGGTCCAATTCCTGATCCTTATGATGAAATGCTCTCAACA
 
. : . : . : . : . : . :
rJMSF042N12+ CCCAATATCTATAATTATCAAGGAACTGTCAATGAAGACTACAATGTAGCAAATACACCT
rJMSF036O24+ ATTATCAAGGAACTGTCAANGAAGACTACAATGTAGCAAATACACCT
rJMFF007E16+ CCCAATATCTATAATTATCAAGGAACTGTCAATGAAGACTACAATGTAGCAAATACACCT
                      ____________________________________________________________
consensus CCCAATATCTATAATTATCAAGGAACTGTCAATGAAGACTACAATGTAGCAAATACACCT
 
. : . : . : . : . : . :
rJMSF042N12+ GCACCAGAAATGCAAGCACCTACTCCTGCTCCAGTCCCACAAAATGATGTCGTAGATGAC
rJMSF036O24+ GCACCAGAAATGCAAGCACCTACTCCTGCTCCAGTCCCACAAAATGATGTCGTAGATGAC
rJMFF007E16+ GCACCAGAAATGCAAGCACCTACTCCTGCTCCAGTCCCACAAAATGATGTCGTAGATGAC
                      ____________________________________________________________
consensus GCACCAGAAATGCAAGCACCTACTCCTGCTCCAGTCCCACAAAATGATGTCGTAGATGAC
 
. : . : . : . : . : . :
rJMSF042N12+ GATGATGAAGAGCCCTTGAATGAAAATGATGATGATGATTTGGATGATGTAGACCAAGGA
rJMSF036O24+ GATGATGAAGAGCCCTTGAATGAAAATGATGATGATGATTTGGATGATGTAGACCAAGGA
rJMFF007E16+ GATGATGAAGAGCCCTTGAATGAAAATGATGATGATGATTTGGATGATGTAGACCAAGGA
                      ____________________________________________________________
consensus GATGATGAAGAGCCCTTGAATGAAAATGATGATGATGATTTGGATGATGTAGACCAAGGA
 
. : . : . : . : . : . :
rJMSF042N12+ GAGGATCTAAACACAGCACATCTAGTTTTGGCTCAGTTTGACAAGGTTACCCGTACCAAG
rJMSF036O24+ GAGGATCTAAACACAGCACATCTAGTTTTGGCTCAGTTTGACAAGGTTACCCGTACCAAG
rJMFF007E16+ GAGGATCTAAACACAGCACATCTAGTTTTGGCTCAGTTTGACAAGGTTACCCGTACCAAG
                      ____________________________________________________________
consensus GAGGATCTAAACACAGCACATCTAGTTTTGGCTCAGTTTGACAAGGTTACCCGTACCAAG
 
. : . : . : . : . : . :
rJMSF042N12+ AGCAGGTGGAAATGCACTCTAAAGGACGGTATAATGCATATAAATAATAAAGATATACTC
rJMSF036O24+ AGCAGGTGGAAATGCACTCTAAAGGACGGTATAATGCATATAAATAATAAAGATATACTC
rJMFF007E16+ AGCAGGTGGAAATGCACTCTAAAGGACGGTATAATGCATATAAATAATAAAGATATACTC
                      ____________________________________________________________
consensus AGCAGGTGGAAATGCACTCTAAAGGACGGTATAATGCATATAAATAATAAAGATATACTC
 
. : . : . : . : . : . :
rJMSF042N12+ TTTAATAAGGCAACAGGAGAGTTTGACTTCTGATTCTGTCAAAAGAAATCCTTCTTGCTA
rJMSF036O24+ TTTAATAAGGCAACAGGAGAGTTTGACTTCTGATTCTGTCAAAAGAAATCCTTCTTGCTA
rJMFF007E16+ TTTAATAAGGCAACAGGAGAGTTTGACTTCTGATTCTGTCAAAAGAAATCCTTCTTGCTA
                      ____________________________________________________________
consensus TTTAATAAGGCAACAGGAGAGTTTGACTTCTGATTCTGTCAAAAGAAATCCTTCTTGCTA
 
. : . : . : . : . : . :
rJMSF042N12+ AAAGAGCGCTGAGTTTGAAGTGAAGTGAAAAGCAAGAATGCTTAGGTATTCTTATAATTG
rJMSF036O24+ AAAGAGCGCTGAGTTTGAAGTGAAGTGAAAAGCAAGAATGCTTAGGTATTCTTATAATTG
rJMFF007E16+ AAAGAGCGCTGAGTTTGAAGTGAAGTGAAAAGCAAGAATGCTTAGGTATTCTTATAATTG
                      ____________________________________________________________
consensus AAAGAGCGCTGAGTTTGAAGTGAAGTGAAAAGCAAGAATGCTTAGGTATTCTTATAATTG
 
. : . : . : . : . : . :
rJMSF042N12+ CTCCTTTTTAATTAAGTAGACCGACCGACCGACCCTCAAGCAAATTGCCTAATATGTGTG
rJMSF036O24+ CTCCTTTTTAATTAAGTAGACCGACCGACCGACCCTCAAGCAAATTGCCTAATATGTGTG
rJMFF007E16+ CTCCTTTTTAATTAAGTAGACCGACCGACCGACCCTCAAGCAAATTGCCTAATATGTGTG
                      ____________________________________________________________
consensus CTCCTTTTTAATTAAGTAGACCGACCGACCGACCCTCAAGCAAATTGCCTAATATGTGTG
 
. : . : . : . : . : . :
rJMSF042N12+ GGACTCTGATTAGTTGCTGTACATAAAGGGGAGAGCTTTTTGGCCATAAATTGAGACTCA
rJMSF036O24+ GGACTCTGATTAGTTGCTGTACATAAAGGGGAGAGCTTTTTGGCCATAAATTGAGACTCA
rJMFF007E16+ GGACTCTGATTAGTTGCTGTACATAAAGGGGAGAGCTTTTTGGCCATAAATTGAGACTCA
                      ____________________________________________________________
consensus GGACTCTGATTAGTTGCTGTACATAAAGGGGAGAGCTTTTTGGCCATAAATTGAGACTCA
 
. : . : . : . : . : . :
rJMSF042N12+ TTTCCAGACTATATTCCGTAGACTCTGTATGTGGATTATTTTTTGTTGATGTAA
rJMSF036O24+ TTTCCAGACTATATTCCGTAGACTCTGTATGTGGATTATTTTT
rJMFF007E16+ TTTCCAGACTATATTCCGTAGACTCTGTATGTGGATTATTTTTTGTTGATGTAAACCAAA
                      ____________________________________________________________
consensus TTTCCAGACTATATTCCGTAGACTCTGTATGTGGATTATTTTTTGTTGATGTAAACCAAA