Previous Contig 008484:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007D05Sequence559008484 (2)781008484 (2)gb:AY086071_15711292e-24Arabidopsis thaliana clone 21 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007D05- GTAAACTCAGTCCGATCAAAACCCT
                      ____________________________________________________________
consensus GTAAACTCAGTCCGATCAAAACCCT
 
. : . : . : . : . : . :
JMFF007D05- AACTCGCTTTCAGTTTTTCTCTACACTCTACAGTATAATACTCTCTACCAAACTTCCGCC
                      ____________________________________________________________
consensus AACTCGCTTTCAGTTTTTCTCTACACTCTACAGTATAATACTCTCTACCAAACTTCCGCC
 
. : . : . : . : . : . :
JMFF007D05- ATCGCGTAATCAATTGGCTTCAGTAGAAATGGAGCTCTGCACTTGTCGAGCTGTATCCAA
                      ____________________________________________________________
consensus ATCGCGTAATCAATTGGCTTCAGTAGAAATGGAGCTCTGCACTTGTCGAGCTGTATCCAA
 
. : . : . : . : . : . :
JMFF007D05- TCTTTCAAAGCCTGCTGGCCTTTTCGCTCCCCATCCGAGAAGCCATGATCGCGTTCCCTG
                      ____________________________________________________________
consensus TCTTTCAAAGCCTGCTGGCCTTTTCGCTCCCCATCCGAGAAGCCATGATCGCGTTCCCTG
 
. : . : . : . : . : . :
JMFF007D05- GATCAAGAAGGTTTCGCGTTTTGGGTTCACTCCAGGAGTGTTACAGTATTCCAATTCATC
rJMFF007D05+ C
                      ____________________________________________________________
consensus GATCAAGAAGGTTTCGCGTTTTGGGTTCACTCCAGGAGTGTTACAGTATTCCAATTCATC
 
. : . : . : . : . : . :
JMFF007D05- TATCAGATTGGCAAAATCAGATGAAGCATCTAGCTTTACTAGTCAGTATGTGAAAGATGA
rJMFF007D05+ TATCAGATTGGCAAAATCAGATGAAGCATCTAGCTTTACTAGTCAGTATGTGAAAGATGA
                      ____________________________________________________________
consensus TATCAGATTGGCAAAATCAGATGAAGCATCTAGCTTTACTAGTCAGTATGTGAAAGATGA
 
. : . : . : . : . : . :
JMFF007D05- ACCTGATAGCATTGTAACTGCTGACGATTCTAAATCTGGTGAGCAGACTAGTGCTTATGT
rJMFF007D05+ ACCTGATAGCATTGTAACTGCTGACGATTCTAAATCTGGTGAGCAGACTAGTGCTTATGT
                      ____________________________________________________________
consensus ACCTGATAGCATTGTAACTGCTGACGATTCTAAATCTGGTGAGCAGACTAGTGCTTATGT
 
. : . : . : . : . : . :
JMFF007D05- ATCTTTGCATAATGAAGCATCTGAACAAGAGGGTCACTATGACACTGCCACGGAGAATGA
rJMFF007D05+ ATCTTTGCATAATGAAGCATCTGAACAAGAGGGTCACTATGACACTGCCACGGAGAATGA
                      ____________________________________________________________
consensus ATCTTTGCATAATGAAGCATCTGAACAAGAGGGTCACTATGACACTGCCACGGAGAATGA
 
. : . : . : . : . : . :
JMFF007D05- GAAATCAGAAGACGATCCTCTCTCTGAATTTCGAGGAAAATTGTCTGAGATTTTTGATCA
rJMFF007D05+ GAAATCAGAAGACGATCCTCTCTCTGAATTTCGAGGAAAATTGTCTGAGATTTTTGATCA
                      ____________________________________________________________
consensus GAAATCAGAAGACGATCCTCTCTCTGAATTTCGAGGAAAATTGTCTGAGATTTTTGATCA
 
. : . : . : . : . : . :
JMFF007D05- GCTTGATATAGAGTTTGATTCTGAAAATTTGTCCTCGCTGTTTATACTTGGTGG
rJMFF007D05+ GCTTGATATAGAGTTTGATTCTGAAAATTTGTCCTCGCTGTTTATACTTGGTGGTGGTGG
                      ____________________________________________________________
consensus GCTTGATATAGAGTTTGATTCTGAAAATTTGTCCTCGCTGTTTATACTTGGTGGTGGTGG
 
. : . : . : . : . : . :
rJMFF007D05+ TGGTGTTGCCCTTTGGTTAACAAGTGCTGTTGTTGGTGCTATTGATTCTATCCCTCTGTT
                      ____________________________________________________________
consensus TGGTGTTGCCCTTTGGTTAACAAGTGCTGTTGTTGGTGCTATTGATTCTATCCCTCTGTT
 
. : . : . : . : . : . :
rJMFF007D05+ CCCCAAATTGATGGAAGTTGTTGGCATTGGCTATACAGTGTGGTTCACTAACCGCTATCT
                      ____________________________________________________________
consensus CCCCAAATTGATGGAAGTTGTTGGCATTGGCTATACAGTGTGGTTCACTAACCGCTATCT
 
. : . : . : . : . : . :
rJMFF007D05+ GCTACTCAAGAAAAACAGGGAGGAGTTAGCGTCAAAAGTCGAAGAGATCAAGAAGCAAGT
                      ____________________________________________________________
consensus GCTACTCAAGAAAAACAGGGAGGAGTTAGCGTCAAAAGTCGAAGAGATCAAGAAGCAAGT
 
. : . : . : . : . : . :
rJMFF007D05+ GTTGGGTTCAGATCGCGATTGAGCCCTGTTCTACGAAGGCTGAAGATAAAGGGGGGCTCC
                      ____________________________________________________________
consensus GTTGGGTTCAGATCGCGATTGAGCCCTGTTCTACGAAGGCTGAAGATAAAGGGGGGCTCC
 
. : . : . : . : . : . :
rJMFF007D05+ ATGTTTAAGCGAAATTCGTTTTCTTTTAAGTGTCTGTGGCAGTTGTGCATGCCAGAATGG
                      ____________________________________________________________
consensus ATGTTTAAGCGAAATTCGTTTTCTTTTAAGTGTCTGTGGCAGTTGTGCATGCCAGAATGG
 
. : . : . : . : . : . :
rJMFF007D05+ GGATGGAGTTTTTGGTGTATATTTATATATATATGTTTTCATGTCCATCTTGGGATATCC
                      ____________________________________________________________
consensus GGATGGAGTTTTTGGTGTATATTTATATATATATGTTTTCATGTCCATCTTGGGATATCC
 
. : . : . : . : . : . :
rJMFF007D05+ TTTGTTATCTGGTAGTAGAGTTGAACATGCCTGTAGATACTGCAGCTTCACAATTCTATA
                      ____________________________________________________________
consensus TTTGTTATCTGGTAGTAGAGTTGAACATGCCTGTAGATACTGCAGCTTCACAATTCTATA
 
. : . : . : . : . : . :
rJMFF007D05+ GAGATGGTTGATAGATGCTTTCATGGATTATGCTATTAGTTTTTTTAAAACTAGAGCAAT
                      ____________________________________________________________
consensus GAGATGGTTGATAGATGCTTTCATGGATTATGCTATTAGTTTTTTTAAAACTAGAGCAAT