Previous Contig 008475:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007B09Sequence490000359 (8)gb:AY690424_16224551e-09Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN737008475 (6)gb:AY690424_16224551e-72Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN
JMFF014O09Sequence477000359 (8)gb:AY690424_16224552e-23Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN833008475 (6)gb:AY690424_1622455e-113Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN
JMFF037J13Sequence561000359 (8)gb:AY690424_16224552e-38Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN733008475 (6)gb:AY690424_1622455e-104Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN
JMFF041J08Sequence651000359 (8)gb:AY690424_16224553e-41Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN600008475 (6)gb:AY690424_16224557e-73Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN
JMFN008A16Sequence618008475 (6)gb:AY690424_16224555e-79Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN
JMSF010B04Sequence276000359 (8)739008475 (6)gb:AY690424_16224551e-72Lycopersicon esculentum cultivar Rutgers glucose-6-phosphate isomerase (GPI) mRN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF014O09+ CAGTAGGTATTTACAGCAGCTGNTT
                      ____________________________________________________________
consensus CAGTAGGTATTTACAGCAGCTGNTT
 
. : . : . : . : . : . :
rJMFF014O09+ ATGGAGTCGCTTGGCAAAGAATTTGATCTCGATGGTAATCGGGTGAATCAAGGGATCACA
                      ____________________________________________________________
consensus ATGGAGTCGCTTGGCAAAGAATTTGATCTCGATGGTAATCGGGTGAATCAAGGGATCACA
 
. : . : . : . : . : . :
rJMFF037J13+ AAGGAAGCACAGATCAGCATGCTTACATCCAACAACTGAGAGAGGGT
rJMFF014O09+ GTCTATGGAAACAAAGGAAGCACAGATCAGCATGCTTTCATCCAACAACTGAGAGAGGGT
                      ____________________________________________________________
consensus GTCTATGGAAACAAAGGAAGCACAGATCAGCATGCTTTCATCCAACAACTGAGAGAGGGT
 
. : . : . : . : . : . :
rJMFF037J13+ GTGCACAATTTCTTTGTGACGTTTATCGAAGTACTGCGCGATAGGCCCCCGGGTCATGAT
rJMFF014O09+ GTGCACAATTTCTTTGTGACGTTTATCGAAGTACTGCGCGATAGGCCCCCGGGTCATGAT
                      ____________________________________________________________
consensus GTGCACAATTTCTTTGTGACGTTTATCGAAGTACTGCGCGATAGGCCCCCGGGTCATGAT
 
. : . : . : . : . : . :
rJMFF037J13+ TGGGAACTTGAACCTGGTGTCACTTGCGGTGACTATCTTTTCGGAATGTTACAGGGAACG
rJMFF014O09+ TGGGAACTTGAACCTGGTGTCACTTGCGGTGACTATCTTTTCGGAATGTTACAGGGAACG
JMFN008A16- CTGGTGTCACTTGCGGTGACTATCTTTTCGGAATGTTACAGGGAACG
rJMFF041J08+ TCGGAATGTTACAGGGAACG
rJMSF010B04+ TCGGAATGTTACAGGGAACG
rJMFF007B09+ GGAATGTTACAGGGAACG
                      ____________________________________________________________
consensus TGGGAACTTGAACCTGGTGTCACTTGCGGTGACTATCTTTTCGGAATGTTACAGGGAACG
 
. : . : . : . : . : . :
rJMFF037J13+ AGGTCAGCTCTGTATGCCAATGACCGAGAGTCTATCACGGTGACTGTACAAGAAGTGACA
rJMFF014O09+ AGGTCAGCTCTGTATGCCAATGACCGAGAGTCTATCACGGTGACTGTACAAGAAGTGACA
JMFN008A16- AGGTCAGCTCTGTATGCCAATGACCGAGAGTCTATCACGGTGACTGTACAAGAAGTGACA
rJMFF041J08+ AGGTCAGCTCTGTATGCCAATGACCGAGAGTCTATCACGGTGACTGTACAAGAAGTGACA
rJMSF010B04+ AGGTCAGCTCTGTATGCCAATGACCGAGAGTCTATCACGGTGACTGTACAAGAAGTGACA
rJMFF007B09+ AGGTCAGCTCTGTATGCCAATGACCGAGAGTCTATCACGGTGACTGTACAAGAAGTGACA
                      ____________________________________________________________
consensus AGGTCAGCTCTGTATGCCAATGACCGAGAGTCTATCACGGTGACTGTACAAGAAGTGACA
 
. : . : . : . : . : . :
rJMFF037J13+ CCTAGATCCGTC-GGAGCCCTAGTAGCACTCTATGAGCGAGCTGTTGGGATTTATGCTTC
rJMFF014O09+ CCTAGATCCGTCNGGAGCCCTAGTAGCACTCTATGAGCGAGCTGTTGGGATTTATGCTTC
JMFN008A16- CCTAGATCCGTC-GGAGCCCTAGTAGCACTCTATGAGCGAGCTGTTGGGATTTATGCTTC
rJMFF041J08+ CCTAGATCCGTC-GGAGCCCTAGTAGCACTCTATGAGCGAGCTGTTGGGATTTATGCTTC
rJMSF010B04+ CCTAGATCCGTC-GGAGCCCTAGTAGCACTCTATGAGCGAGCTGTTGGGATTTATGCTTC
rJMFF007B09+ CCTAGATCCGTC-GGAGCCCTAGTAGCACTCTATGAGCGAGCTGTTGGGATTTATGCTTC
                      ____________________________________________________________
consensus CCTAGATCCGTC-GGAGCCCTAGTAGCACTCTATGAGCGAGCTGTTGGGATTTATGCTTC
 
. : . : . : . : . : . :
rJMFF037J13+ ACTTGTCAATATTAACGCTTACCATCAACCGGGTGTAGAAGCAGGTAAAAAAGCCGCGGG
rJMFF014O09+ ACTTGTCAATATTAACGCTTACCATCAACCGGGTGTAGAAGCAGGTAAAAAAGCCGCGGG
JMFN008A16- ACTTGTCAATATTAACGCTTACCATCAACCGGGTGTAGAAGCAGGTAAAAAAGCCGCGGG
rJMFF041J08+ ACTTGTCAATATTAACGCTTACCATCAACCGGGTGTAGAAGCAGGTAAAAAAGCCGCGGG
rJMSF010B04+ ACTTGTCAATATTAACGCTTACCATCAACCGGGTGTAGAAGCAGGTAAAAAAGCCGCGGG
rJMFF007B09+ ACTTGTCAATATTAACGCTTACCATCAACCGGGTGTAGAAGCAGGTAAAAAAGCCGCGGG
                      ____________________________________________________________
consensus ACTTGTCAATATTAACGCTTACCATCAACCGGGTGTAGAAGCAGGTAAAAAAGCCGCGGG
 
. : . : . : . : . : . :
rJMFF037J13+ AGAAGTTCTAGCCCTACAAAAGCGTGTTCTTGCAGTACTTAATGAAGCCAGCTGCAAAGA
rJMFF014O09+ AGAAGTTCTAGCCCTACAAAAGCGTGTTCTTGCAGTACTTAATGAAGCCAGCTGCAAAGA
JMFN008A16- AGAAGTTCTAGCCCTACAAAAGCGTGTTCTTGCAGTACTTAATGAAGCCAGCTGCAAAGA
rJMFF041J08+ AGAAGTTCTAGCCCTACAAAAGCGTGTTCTTGCAGTACTTAATGAAGCCAGCTGCAAAGA
rJMSF010B04+ AGAAGTTCTAGCCCTACAAAAGCGTGTTCTTGCAGTACTTAATGAAGCCAGCTGCAAAGA
rJMFF007B09+ AGAAGTTCTAGCCCTACAAAAGCGTGTTCTTGCAGTACTTAATGAAGCCAGCTGCAAAGA
                      ____________________________________________________________
consensus AGAAGTTCTAGCCCTACAAAAGCGTGTTCTTGCAGTACTTAATGAAGCCAGCTGCAAAGA
 
. : . : . : . : . : . :
rJMFF037J13+ GCCAGTTGAACCGTTAACGTTGGAAGAAATTGCTGACAGATGTCACGCCCTCGAAGATAT
rJMFF014O09+ GCCAGTTGAACCGTTAACGTTGGAAGAAATTGCTGACAGATGTCACGCCCTCGAAGATAT
JMFN008A16- GCCAGTTGAACCGTTAACGTTGGAAGAAATTGCTGACAGATGTCACGCCCTCGAAGATAT
rJMFF041J08+ GCCAGTTGAACCGTTAACGTTGGAAGAAATTGCTGACAGATGTCACGCCCTCGAAGATAT
rJMSF010B04+ GCCAGTTGAACCGTTAACGTTGGAAGAAATTGCTGACAGATGTCACGCCCTCGAAGATAT
rJMFF007B09+ GCCAGTTGAACCGTTAACGTTGGAAGAAATTGCTGACAGATGTCACGCCCTCGAAGATAT
                      ____________________________________________________________
consensus GCCAGTTGAACCGTTAACGTTGGAAGAAATTGCTGACAGATGTCACGCCCTCGAAGATAT
 
. : . : . : . : . : . :
rJMFF037J13+ CGAAATGATCTACAAGATAATCGCGCACATGGCAGCCAACGACAGAGCTCTGATCGCTGA
rJMFF014O09+ CGAAATGATCTACAAGATAATCGCGCACATGGCAGCCAACGACAGAGCTCTGATCGCTGA
JMFN008A16- CGAAATGATCTACAAGATAATCGCGCACATGGCAGCCAACGACAGAGCTCTGATCGCTGA
rJMFF041J08+ CGAAATGATCTACAAGATAATCGCGCACATGGCAGCCAACGACAGAGCTCTGATCGCTGA
rJMSF010B04+ CGAAATGATCTACAAGATAATCGCGCACATGGCAGCCAACGACAGAGCTCTGATCGCTGA
rJMFF007B09+ CGAAATGATCTACAAGATAATCGCGCACATGGCAGCCAACGACAGAGCTCTGATCGCTGA
                      ____________________________________________________________
consensus CGAAATGATCTACAAGATAATCGCGCACATGGCAGCCAACGACAGAGCTCTGATCGCTGA
 
. : . : . : . : . : . :
rJMFF037J13+ AGGTAACTGTGGTTCACCTCGAAGCGTCAAAGTTTTTCTGGGCGAGTGCAATGTCGATGA
rJMFF014O09+ AGGTAACTGTGGTTCACCTCGAAGCGTCAAAGTTTTTCTGGGCGAGTGCAATGTCGATGA
JMFN008A16- AGGTAACTGTGGTTCACCTCGAAGCGTCAAAGTTTTTCTGGGCGAGTGCAATGTCGATGA
rJMFF041J08+ AGGTAACTGTGGTTCACCTCGAAGCGTCAAAGTTTTTCTGGGCGAGTGCAATGTCGATGA
rJMSF010B04+ AGGTAACTGTGGTTCACCTCGAAGCGTCAAAGTTTTTCTGGGCGAGTGCAATGTCGATGA
rJMFF007B09+ AGGTAACTGTGGTTCACCTCGAAGCGTCAAAGTTTTTCTGGGCGAGTGCAATGTCGATGA
                      ____________________________________________________________
consensus AGGTAACTGTGGTTCACCTCGAAGCGTCAAAGTTTTTCTGGGCGAGTGCAATGTCGATGA
 
. : . : . : . : . : . :
rJMFF037J13+ GTTGTATGCCTAGTTCACTAGTTAAACACGCCTGAAATAAAAAGAAAAAATCGATTTTTT
rJMFF014O09+ GTTGTATGCCTAGTTCACTAGTTAAACACGCCTGAAATAAAAAGAAAAAATCGATTTTTT
JMFN008A16- GTTGTATGCCTAGTTCACTAGTTAAACACGCCTGAAATAAAAAGAAAAAATCGATTTTTT
rJMFF041J08+ GTTGTATGCCTAGTTCACTAGTTAAACACGCCTGAAATAAAAAGAAAAAATCGATTTTTT
rJMSF010B04+ GTTGTATGCCTAGTTCACTAGTTAAACACGCCTGAAATAAAAAGAAAAAATCGATTTTTT
rJMFF007B09+ GTTGTATGCCTAGTTCACTAGTTAAACACGCCTGAAATAAAAAGAAAAAATCGATTTTTT
                      ____________________________________________________________
consensus GTTGTATGCCTAGTTCACTAGTTAAACACGCCTGAAATAAAAAGAAAAAATCGATTTTTT
 
. : . : . : . : . : . :
rJMFF037J13+ AGACTTTAGAGCCCCTCCCTCGTTCCTCTATTCCAGAGTCGTTGAATGCTATGCTATCCC
rJMFF014O09+ AGACTTTAGAGCCCCTCCCTCGTTCCTCTATTCCAGAGTCGTTGAATGCTATGCTATCCC
JMFN008A16- AGACTTTAGAGCCCCTCCCTCGTTCCTCTATTCCAGAGTCGTTGAATGCTATGCTATCCC
rJMFF041J08+ AGACTTTAGAGCCCCTCCCTCGTTCCTCTATTCCAGAGTCGTTGAATGCTATGCTATCCC
rJMSF010B04+ AGACTTTAGAGCCCCTCCCTCGTTCCTCTATTCCAGAGTCGTTGAATGCTATGCTATCCC
rJMFF007B09+ AGACTTTAGAGCCCCTCCCTCGTTCCTCTATTCCAGAGTCGTTGAATGCTATGCTATCCC
                      ____________________________________________________________
consensus AGACTTTAGAGCCCCTCCCTCGTTCCTCTATTCCAGAGTCGTTGAATGCTATGCTATCCC
 
. : . : . : . : . : . :
rJMFF037J13+ TGTCAATCAA-TTTCAATGAGCAACACA
rJMFF014O09+ TGTCAATCAATTTTCAATGAGCAACACA
JMFN008A16- TGTCAATCAATTTTCAATGAGCAACACATACT
rJMFF041J08+ TGTCAATCAATTTTCAATGAGCAACACATACTCTTTCTT
rJMSF010B04+ TGTCAATCAATTTTCAATGAGCAACACATACTCTTTCTTTCTTTCTTTGTCTTTTTTTGT
rJMFF007B09+ TGTCAATCAATTTTCAATGAGCAACACATACTCTTTCTTTCTTTCTTTGTCTTTTTTTGT
                      ____________________________________________________________
consensus TGTCAATCAATTTTCAATGAGCAACACATACTCTTTCTTTCTTTCTTTGTCTTTTTTTGT
 
. : . : . : . : . : . :
rJMSF010B04+ TTTTGGTTTGATTGCGTTGCCCCCGCTCCCTCTGTTTTGGAAGAGCATAAAGAGAATATC
rJMFF007B09+ TTTTGGTTTGATTGCGTTGCCCCCGCTCCCTCTGTTTTGGAAGAGCATAAAGAGAATATC
                      ____________________________________________________________
consensus TTTTGGTTTGATTGCGTTGCCCCCGCTCCCTCTGTTTTGGAAGAGCATAAAGAGAATATC
 
. : . : . : . : . : . :
rJMSF010B04+ GGCCCCGAGATTGTTCATTGACCTCAACTGTTATTGTCAGGCCAGCAGGAATTTGATGTT
rJMFF007B09+ GGCCCCGAGATTGTTCATTGACCTCAACTGTTATTGTCAGGCCAGCAGGAATTTGATGTT
                      ____________________________________________________________
consensus GGCCCCGAGATTGTTCATTGACCTCAACTGTTATTGTCAGGCCAGCAGGAATTTGATGTT